Incidental Mutation 'R5099:Vmn1r81'
ID388176
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12260321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 120 (I120T)
Ref Sequence ENSEMBL: ENSMUSP00000153780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably benign
Transcript: ENSMUST00000086232
AA Change: I120T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: I120T

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227080
AA Change: I120T

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000227973
AA Change: I120T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228482
AA Change: I120T

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000228764
AA Change: I120T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2967:Vmn1r81 UTSW 7 12260037 missense probably damaging 0.99
R2983:Vmn1r81 UTSW 7 12260669 missense probably benign 0.02
R4549:Vmn1r81 UTSW 7 12259822 missense probably damaging 0.99
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6630:Vmn1r81 UTSW 7 12260657 nonsense probably null
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R6754:Vmn1r81 UTSW 7 12259847 missense probably damaging 0.98
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGTGCAGTTGCCAGATTGC -3'
(R):5'- AGAGCACTTGACTTTATCCAACTGC -3'

Sequencing Primer
(F):5'- CTTGGAGCAAACCATGAGCAGTAC -3'
(R):5'- GCTTGTCTCTAATCTCAAAAGGC -3'
Posted On2016-06-06