Incidental Mutation 'R5099:Gsr'
ID388180
Institutional Source Beutler Lab
Gene Symbol Gsr
Ensembl Gene ENSMUSG00000031584
Gene Nameglutathione reductase
SynonymsD8Ertd238e, Gr-1, Gr1
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33652523-33698163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33671528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 121 (I121N)
Ref Sequence ENSEMBL: ENSMUSP00000033992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033992]
Predicted Effect probably damaging
Transcript: ENSMUST00000033992
AA Change: I121N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033992
Gene: ENSMUSG00000031584
AA Change: I121N

DomainStartEndE-ValueType
low complexity region 17 22 N/A INTRINSIC
Pfam:Pyr_redox_2 43 368 1.2e-73 PFAM
Pfam:Pyr_redox 211 292 1.7e-21 PFAM
Pfam:Pyr_redox_dim 389 500 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154745
Meta Mutation Damage Score 0.7497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
PHENOTYPE: A homozygous mutation disrupting this gene between exon 1-2 results in a decreased retinal artery-to-vein ratio. Another small deletion of exons 2-5 has no phenotypic effect. Electrophoretic alleles designated a (C57BL/6, CE) vs. allele b (SJL, SWR) are known. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Gsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Gsr APN 8 33682584 splice site probably benign
IGL02481:Gsr APN 8 33685541 splice site probably benign
IGL02941:Gsr APN 8 33689425 missense probably damaging 0.98
IGL03242:Gsr APN 8 33685599 missense probably benign
IGL03293:Gsr APN 8 33694996 splice site probably benign
R0208:Gsr UTSW 8 33689355 missense possibly damaging 0.45
R0490:Gsr UTSW 8 33671512 splice site probably benign
R0492:Gsr UTSW 8 33681575 splice site probably benign
R0524:Gsr UTSW 8 33669180 critical splice donor site probably null
R1104:Gsr UTSW 8 33669921 missense probably damaging 1.00
R1976:Gsr UTSW 8 33680260 splice site probably null
R2507:Gsr UTSW 8 33680288 missense probably benign 0.45
R2508:Gsr UTSW 8 33680288 missense probably benign 0.45
R3726:Gsr UTSW 8 33671537 missense probably benign 0.11
R4573:Gsr UTSW 8 33693853 missense probably benign 0.00
R4623:Gsr UTSW 8 33680305 missense probably damaging 0.99
R4639:Gsr UTSW 8 33697256 missense probably damaging 1.00
R4713:Gsr UTSW 8 33680319 critical splice donor site probably null
R4717:Gsr UTSW 8 33693858 nonsense probably null
R4992:Gsr UTSW 8 33693913 missense probably damaging 1.00
R6019:Gsr UTSW 8 33693807 missense probably damaging 0.97
R7046:Gsr UTSW 8 33695062 missense probably damaging 1.00
R7570:Gsr UTSW 8 33669165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTCTGAGCATGCTTC -3'
(R):5'- CTACTGGGTCAAAGGCCTACTG -3'

Sequencing Primer
(F):5'- TCTGAGCATGCTTCAGGATGGAAC -3'
(R):5'- CTGAATCAGTAAGGTCAGCTTCC -3'
Posted On2016-06-06