Incidental Mutation 'R5099:Sp2'
ID388184
Institutional Source Beutler Lab
Gene Symbol Sp2
Ensembl Gene ENSMUSG00000018678
Gene NameSp2 transcription factor
Synonyms
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96953341-96982959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96961349 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 250 (K250E)
Ref Sequence ENSEMBL: ENSMUSP00000103250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062652] [ENSMUST00000107623] [ENSMUST00000107624]
Predicted Effect probably damaging
Transcript: ENSMUST00000062652
AA Change: K244E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051403
Gene: ENSMUSG00000018678
AA Change: K244E

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107623
AA Change: K244E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103249
Gene: ENSMUSG00000018678
AA Change: K244E

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107624
AA Change: K250E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103250
Gene: ENSMUSG00000018678
AA Change: K250E

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107626
AA Change: K250E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103252
Gene: ENSMUSG00000018678
AA Change: K250E

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 209 222 N/A INTRINSIC
low complexity region 287 319 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 426 437 N/A INTRINSIC
ZnF_C2H2 525 549 5.14e-3 SMART
ZnF_C2H2 555 579 8.47e-4 SMART
ZnF_C2H2 585 607 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186326
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. The protein can act as a transcriptional activator or repressor, depending on the promoter and cell type. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: No homozygous null mice survived beyond E10.5, with decrease embryo size and embryonic growth retardation starting at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Sp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00228:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00467:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00470:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00476:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00505:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00535:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL01865:Sp2 APN 11 96961042 missense probably damaging 1.00
IGL02170:Sp2 APN 11 96956210 missense probably damaging 0.99
IGL03342:Sp2 APN 11 96961762 missense probably damaging 0.99
PIT4696001:Sp2 UTSW 11 96961973 missense probably damaging 1.00
R0082:Sp2 UTSW 11 96961699 missense probably damaging 1.00
R0086:Sp2 UTSW 11 96957427 missense probably damaging 1.00
R0525:Sp2 UTSW 11 96956098 critical splice donor site probably benign
R0789:Sp2 UTSW 11 96961376 missense probably benign 0.18
R1463:Sp2 UTSW 11 96963456 critical splice acceptor site probably benign
R1941:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2049:Sp2 UTSW 11 96961365 missense probably benign 0.09
R2153:Sp2 UTSW 11 96962008 missense possibly damaging 0.92
R2230:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2232:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2237:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2238:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2247:Sp2 UTSW 11 96962018 splice site probably null
R4638:Sp2 UTSW 11 96957474 missense possibly damaging 0.89
R5016:Sp2 UTSW 11 96955832 missense probably damaging 0.96
R5125:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5178:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5828:Sp2 UTSW 11 96960985 intron probably benign
R6286:Sp2 UTSW 11 96961546 missense probably benign 0.01
R6997:Sp2 UTSW 11 96957726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAAGTTCTGAGAGGGCTTCTG -3'
(R):5'- TCCTGTCCAGAAGTCAAGTACG -3'

Sequencing Primer
(F):5'- ATCTGGACCACCTGCTGCTG -3'
(R):5'- TGTCCAGAAGTCAAGTACGACTAC -3'
Posted On2016-06-06