Incidental Mutation 'R5099:Arsa'
ID388190
Institutional Source Beutler Lab
Gene Symbol Arsa
Ensembl Gene ENSMUSG00000022620
Gene Namearylsulfatase A
SynonymsAs2, As-2, ASA, AS-A
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R5099 (G1)
Quality Score218
Status Validated
Chromosome15
Chromosomal Location89472476-89477425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89475339 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 80 (L80P)
Ref Sequence ENSEMBL: ENSMUSP00000127646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165199]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136218
Predicted Effect probably damaging
Transcript: ENSMUST00000165199
AA Change: L80P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127646
Gene: ENSMUSG00000022620
AA Change: L80P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Sulfatase 20 345 4.2e-79 PFAM
Pfam:Sulfatase_C 367 501 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168052
Predicted Effect probably benign
Transcript: ENSMUST00000168270
SMART Domains Protein: ENSMUSP00000130574
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
Pfam:Sulfatase 1 37 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168835
Meta Mutation Damage Score 0.2748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mice exhibit impaired balance and spatial learning ability. Sulfatide accumulates in the white matter of the brain and a reduced myelin sheath thickness in the corpus callosum and optic nerves is seen. A low frequency of head tremor develops after 2 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Arsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Arsa APN 15 89473351 missense probably benign 0.04
IGL02381:Arsa APN 15 89475537 nonsense probably null
IGL02416:Arsa APN 15 89474788 missense probably damaging 1.00
IGL02997:Arsa APN 15 89474038 missense probably damaging 0.99
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0630:Arsa UTSW 15 89474004 splice site probably benign
R1052:Arsa UTSW 15 89475177 missense probably damaging 1.00
R1079:Arsa UTSW 15 89474225 splice site probably benign
R1807:Arsa UTSW 15 89475322 missense possibly damaging 0.54
R1943:Arsa UTSW 15 89473539 missense probably damaging 1.00
R2231:Arsa UTSW 15 89475722 start codon destroyed probably null
R5461:Arsa UTSW 15 89473275 missense probably benign
R6259:Arsa UTSW 15 89475521 missense probably damaging 1.00
R7159:Arsa UTSW 15 89474718 splice site probably null
R7188:Arsa UTSW 15 89475627 nonsense probably null
R7735:Arsa UTSW 15 89474949 nonsense probably null
R7943:Arsa UTSW 15 89474089 missense probably damaging 1.00
R8127:Arsa UTSW 15 89474864 missense probably damaging 1.00
R8287:Arsa UTSW 15 89473390 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AATCGGTGGAAGCCCTGATG -3'
(R):5'- GGTTCACAGATTTCTATGTGCCTG -3'

Sequencing Primer
(F):5'- CCTGATGCGGGGGCAGG -3'
(R):5'- GCCTGTGTCTCTGTGCACG -3'
Posted On2016-06-06