Incidental Mutation 'R5099:Olfr206'
ID388191
Institutional Source Beutler Lab
Gene Symbol Olfr206
Ensembl Gene ENSMUSG00000066257
Gene Nameolfactory receptor 206
SynonymsMOR182-4, GA_x54KRFPKG5P-55560552-55559632
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5099 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59344675-59349246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59344903 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 266 (G266D)
Ref Sequence ENSEMBL: ENSMUSP00000146906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084791] [ENSMUST00000207927]
Predicted Effect probably benign
Transcript: ENSMUST00000084791
AA Change: G266D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000081849
Gene: ENSMUSG00000066257
AA Change: G266D

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 6.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 34 295 2.6e-5 PFAM
Pfam:7tm_1 40 289 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207927
AA Change: G266D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Olfr206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Olfr206 APN 16 59345161 missense probably damaging 0.97
IGL02106:Olfr206 APN 16 59345024 missense probably benign 0.00
IGL02839:Olfr206 APN 16 59345390 missense probably benign 0.01
IGL03010:Olfr206 APN 16 59344772 utr 3 prime probably benign
R1163:Olfr206 UTSW 16 59345062 missense probably damaging 0.99
R1507:Olfr206 UTSW 16 59345493 missense probably damaging 1.00
R1670:Olfr206 UTSW 16 59345427 missense possibly damaging 0.79
R2881:Olfr206 UTSW 16 59344852 missense probably damaging 1.00
R2925:Olfr206 UTSW 16 59345343 nonsense probably null
R4479:Olfr206 UTSW 16 59344867 missense probably damaging 0.99
R4891:Olfr206 UTSW 16 59345471 missense possibly damaging 0.87
R5085:Olfr206 UTSW 16 59345086 missense probably damaging 0.99
R5218:Olfr206 UTSW 16 59344907 missense probably benign
R6019:Olfr206 UTSW 16 59345435 missense possibly damaging 0.48
R6773:Olfr206 UTSW 16 59345216 missense probably damaging 1.00
R7068:Olfr206 UTSW 16 59345204 missense possibly damaging 0.94
R7173:Olfr206 UTSW 16 59345147 missense probably benign 0.00
R7192:Olfr206 UTSW 16 59345179 missense probably benign 0.44
R7485:Olfr206 UTSW 16 59345324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCAAGTAAGAGCAAAGGTTG -3'
(R):5'- CCATCTCTTAACACATTGGTCG -3'

Sequencing Primer
(F):5'- GCAAAGGTTGTAGAATGGACTTC -3'
(R):5'- TCCATACAAATCAGTACCTCTGTG -3'
Posted On2016-06-06