Incidental Mutation 'R5099:Prr22'
ID388193
Institutional Source Beutler Lab
Gene Symbol Prr22
Ensembl Gene ENSMUSG00000090273
Gene Nameproline rich 22
SynonymsLOC224908, Gm546
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5099 (G1)
Quality Score170
Status Validated
Chromosome17
Chromosomal Location56770250-56772208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56771467 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 207 (F207L)
Ref Sequence ENSEMBL: ENSMUSP00000127457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000007747] [ENSMUST00000086801] [ENSMUST00000168666]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007747
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168666
AA Change: F207L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273
AA Change: F207L

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187612
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Jakmip2 A G 18: 43,568,108 I414T probably benign Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Prr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Prr22 UTSW 17 56770551 unclassified probably benign
R0787:Prr22 UTSW 17 56771072 missense possibly damaging 0.71
R2290:Prr22 UTSW 17 56771884 missense probably benign
R4749:Prr22 UTSW 17 56771274 missense possibly damaging 0.51
R6268:Prr22 UTSW 17 56771587 missense probably damaging 0.98
R6339:Prr22 UTSW 17 56771490 missense probably benign 0.02
R6542:Prr22 UTSW 17 56770527 splice site probably null
R6951:Prr22 UTSW 17 56772028 nonsense probably null
R6991:Prr22 UTSW 17 56771345 missense possibly damaging 0.92
R7721:Prr22 UTSW 17 56771819 missense possibly damaging 0.92
R8352:Prr22 UTSW 17 56771311 missense probably damaging 1.00
R8452:Prr22 UTSW 17 56771311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTACCTTCCAGCGGAG -3'
(R):5'- ATCTTCGAGAAGGACCTTGTC -3'

Sequencing Primer
(F):5'- AGGAGCCTGTGCCTGAG -3'
(R):5'- TAGGAAGAACGCACGTGCC -3'
Posted On2016-06-06