Incidental Mutation 'R5099:Jakmip2'
ID 388196
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 042688-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R5099 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43568108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 414 (I414T)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: I414T

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: I414T

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,112,461 probably null Het
Arsa A G 15: 89,475,339 L80P probably damaging Het
Bdkrb1 A G 12: 105,604,274 D33G probably benign Het
Ccdc178 A T 18: 22,105,591 V323E probably benign Het
Ceacam5 T C 7: 17,745,588 V210A probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Gbp9 A T 5: 105,094,513 L120Q probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsr T A 8: 33,671,528 I121N probably damaging Het
Ift140 T A 17: 25,090,700 M1068K probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Mecom A G 3: 29,985,316 probably benign Het
Mff C T 1: 82,750,471 probably benign Het
Neb C T 2: 52,195,448 C1545Y probably damaging Het
Olfr1083-ps A T 2: 86,607,216 N118K unknown Het
Olfr206 C T 16: 59,344,903 G266D probably benign Het
Olfr467 A G 7: 107,814,602 H6R probably benign Het
Ppm1n A T 7: 19,277,978 L392Q possibly damaging Het
Prr22 T C 17: 56,771,467 F207L probably benign Het
Ptprv T C 1: 135,118,854 noncoding transcript Het
Rin2 G A 2: 145,878,901 C718Y probably damaging Het
Rpgrip1l G A 8: 91,248,722 T1089I probably benign Het
Scn1a A G 2: 66,277,801 V1510A probably damaging Het
Slfn3 A T 11: 83,214,938 Y587F probably damaging Het
Sp2 T C 11: 96,961,349 K250E probably damaging Het
Ssu2 A G 6: 112,359,624 S333P probably benign Het
Strbp T C 2: 37,603,018 T419A probably damaging Het
Tada2b A T 5: 36,476,400 M203K probably benign Het
Tcrg-V5 G T 13: 19,192,716 C111F probably damaging Het
Tmem176b T C 6: 48,834,529 Y62C probably benign Het
Tox G T 4: 6,688,958 Q469K probably benign Het
Tyw5 T C 1: 57,388,705 N243D probably damaging Het
Ube2q2 T A 9: 55,206,023 probably benign Het
Ufl1 C T 4: 25,275,914 R83Q probably damaging Het
Unk A G 11: 116,059,110 Q701R probably benign Het
Vmn1r60 A T 7: 5,544,817 C95S probably damaging Het
Vmn1r81 A G 7: 12,260,321 I120T possibly damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGACACAAGAACACAGCATTTCTAG -3'
(R):5'- AGTGGATATTAGCCCAGAAACTTAG -3'

Sequencing Primer
(F):5'- ACTGCTCATGGTACACTG -3'
(R):5'- TATTAGCCCAGAAACTTAGAATACCC -3'
Posted On 2016-06-06