Incidental Mutation 'R5100:Otos'
ID388198
Institutional Source Beutler Lab
Gene Symbol Otos
Ensembl Gene ENSMUSG00000044055
Gene Nameotospiralin
Synonyms
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92644218-92648841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92644385 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 73 (H73L)
Ref Sequence ENSEMBL: ENSMUSP00000061683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053144] [ENSMUST00000097642] [ENSMUST00000112999]
Predicted Effect probably damaging
Transcript: ENSMUST00000053144
AA Change: H73L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061683
Gene: ENSMUSG00000044055
AA Change: H73L

DomainStartEndE-ValueType
Pfam:OTOS 21 89 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097642
SMART Domains Protein: ENSMUSP00000095247
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
Pfam:MYEOV2 1 57 6.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112999
SMART Domains Protein: ENSMUSP00000108623
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:MYEOV2 48 99 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129730
Predicted Effect probably benign
Transcript: ENSMUST00000148508
SMART Domains Protein: ENSMUSP00000123716
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159803
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display decreased endocochlear potentials and shrunken type II and IV cochlear fibrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Otos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03293:Otos APN 1 92644413 nonsense probably null
R0766:Otos UTSW 1 92645351 missense probably damaging 1.00
R1868:Otos UTSW 1 92644463 missense probably damaging 1.00
R3027:Otos UTSW 1 92644354 missense probably damaging 1.00
R4922:Otos UTSW 1 92644368 missense probably damaging 0.99
R4954:Otos UTSW 1 92644445 missense probably damaging 0.99
R5152:Otos UTSW 1 92644394 missense probably damaging 1.00
R7388:Otos UTSW 1 92644519 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTATACATCGGCTCCTTG -3'
(R):5'- GCTCTTCTAGCGGGGATAATG -3'

Sequencing Primer
(F):5'- GTATACATCGGCTCCTTGAAAGAAAC -3'
(R):5'- CTCTTCTAGCGGGGATAATGAGACAG -3'
Posted On2016-06-06