Mutagenetix > Incidental Mutations

Incidental Mutation 'R5100:Cobll1'

388200

Institutional Source

Beutler Lab

Gene Symbol

Cobll1

Ensembl Gene

ENSMUSG00000034903

Gene Name

Cobl-like 1

Synonyms

D430044D16Rik, Coblr1

MMRRC Submission

042689-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R5100 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65088339-65239403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65125901 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 337 (T337S)

Ref Sequence

ENSEMBL: ENSMUSP00000108049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431] [ENSMUST00000155916]

Predicted Effect

probably benign
Transcript: ENSMUST00000090896
AA Change: T338S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: T338S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	1.3e-38	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	426	438	N/A	INTRINSIC
low complexity region	1023	1034	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102726
AA Change: T338S

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: T338S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1060	1071	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112429
AA Change: T338S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: T338S

Domain	Start	End	E-Value	Type
Pfam:Cobl	148	239	5.4e-49	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112430
AA Change: T337S

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: T337S

Domain	Start	End	E-Value	Type
low complexity region	146	157	N/A	INTRINSIC
Pfam:Cobl	185	263	1.3e-38	PFAM
low complexity region	331	342	N/A	INTRINSIC
low complexity region	425	437	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112431
AA Change: T338S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: T338S

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
Pfam:Cobl	186	264	5.6e-39	PFAM
low complexity region	332	343	N/A	INTRINSIC
low complexity region	464	476	N/A	INTRINSIC
low complexity region	1061	1072	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155916

SMART Domains

Protein: ENSMUSP00000115065
Gene: ENSMUSG00000034903

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
low complexity region	167	178	N/A	INTRINSIC
Pfam:Cobl	206	297	2.4e-37	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	T	11: 72,166,651	M774K	probably damaging	Het
Adamts3	G	A	5: 89,708,643	T357I	probably damaging	Het
Ap3m2	T	A	8: 22,789,388	M408L	probably benign	Het
Apaf1	A	T	10: 90,997,287	N1116K	probably benign	Het
Arhgap31	A	T	16: 38,601,459	I1415N	probably damaging	Het
Arhgef17	A	T	7: 100,881,756	D1374E	possibly damaging	Het
Asxl1	C	G	2: 153,397,931	N546K	probably damaging	Het
Depdc1a	A	T	3: 159,515,520	I163L	probably benign	Het
Flrt3	T	A	2: 140,671,384		probably null	Het
Foxn4	A	T	5: 114,256,759	L369H	possibly damaging	Het
Gm11992	T	C	11: 9,061,290	S244P	probably damaging	Het
Gm14412	C	T	2: 177,315,115	C329Y	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm5113	G	A	7: 30,178,651	V55M	probably damaging	Het
Grhl3	A	G	4: 135,542,675	I599T	probably benign	Het
H2-Q6	G	C	17: 35,425,320	E93Q	probably benign	Het
Hk3	T	C	13: 55,009,030	T570A	probably damaging	Het
Hspb8	T	C	5: 116,415,409	I143M	probably damaging	Het
Kif15	A	G	9: 122,991,994	T655A	probably damaging	Het
Lpin2	G	A	17: 71,243,970	W708*	probably null	Het
Lrit1	T	A	14: 37,062,214	C500S	possibly damaging	Het
Macf1	A	C	4: 123,474,468	C602G	probably benign	Het
Mesd	C	T	7: 83,897,769	R147C	probably damaging	Het
Mfge8	A	T	7: 79,143,300	D139E	probably benign	Het
Ncoa3	G	A	2: 166,050,097	R131Q	probably damaging	Het
Ncoa5	A	G	2: 165,009,389	I188T	probably damaging	Het
Ngp	T	C	9: 110,420,001	L47P	probably damaging	Het
Nhlrc1	T	C	13: 47,014,421	H120R	probably benign	Het
Otos	T	A	1: 92,644,385	H73L	probably damaging	Het
Pcsk5	C	T	19: 17,515,135		probably null	Het
Phc3	T	C	3: 30,922,199	E740G	possibly damaging	Het
Pla2g7	T	C	17: 43,611,376	L382P	probably damaging	Het
Plcd3	C	A	11: 103,078,349	R264L	probably benign	Het
Pms2	A	G	5: 143,928,188	D696G	probably damaging	Het
Ptchd4	A	T	17: 42,503,676	I823F	possibly damaging	Het
Scn9a	T	C	2: 66,534,119	R828G	probably damaging	Het
Spred2	T	A	11: 20,021,291	C386*	probably null	Het
Terb1	A	T	8: 104,495,173	L165*	probably null	Het
Tgm2	A	T	2: 158,127,164	S430R	probably benign	Het
Tnxb	A	T	17: 34,710,928	I2879F	probably damaging	Het
Trpm3	T	G	19: 22,918,766	V977G	probably damaging	Het
Wnt5b	A	C	6: 119,440,488	S139A	probably benign	Het
Zfp820	C	A	17: 21,821,073	V52L	possibly damaging	Het
Zfyve26	T	A	12: 79,280,058	R764*	probably null	Het

Other mutations in Cobll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Cobll1	APN	2	65126013	missense	probably damaging	1.00
IGL01074:Cobll1	APN	2	65107848	missense	probably damaging	1.00
IGL01093:Cobll1	APN	2	65098237	missense	probably damaging	1.00
IGL02411:Cobll1	APN	2	65097740	missense	probably damaging	1.00
IGL02419:Cobll1	APN	2	65151048	missense	probably damaging	1.00
IGL02550:Cobll1	APN	2	65107863	missense	probably damaging	1.00
IGL02607:Cobll1	APN	2	65151085	missense	probably damaging	0.98
IGL02829:Cobll1	APN	2	65126045	missense	probably damaging	1.00
IGL02802:Cobll1	UTSW	2	65098319	missense	probably damaging	0.99
R0313:Cobll1	UTSW	2	65095744	nonsense	probably null
R0314:Cobll1	UTSW	2	65089521	missense	possibly damaging	0.81
R0322:Cobll1	UTSW	2	65102098	missense	possibly damaging	0.84
R0846:Cobll1	UTSW	2	65102065	splice site	probably null
R1163:Cobll1	UTSW	2	65098279	missense	probably damaging	0.96
R1242:Cobll1	UTSW	2	65151169	critical splice acceptor site	probably null
R1364:Cobll1	UTSW	2	65126310	splice site	probably benign
R1445:Cobll1	UTSW	2	65099136	missense	probably damaging	1.00
R1610:Cobll1	UTSW	2	65133642	missense	probably damaging	1.00
R1836:Cobll1	UTSW	2	65126236	missense	probably damaging	1.00
R2102:Cobll1	UTSW	2	65098210	missense	probably damaging	1.00
R3154:Cobll1	UTSW	2	65107050	missense	probably benign	0.00
R4580:Cobll1	UTSW	2	65151073	missense	probably benign	0.00
R4638:Cobll1	UTSW	2	65099237	missense	probably benign	0.03
R4684:Cobll1	UTSW	2	65099028	missense	possibly damaging	0.90
R4906:Cobll1	UTSW	2	65097693	missense	probably benign	0.01
R4923:Cobll1	UTSW	2	65099258	missense	possibly damaging	0.87
R5269:Cobll1	UTSW	2	65133771	nonsense	probably null
R5419:Cobll1	UTSW	2	65103357	missense	possibly damaging	0.57
R5637:Cobll1	UTSW	2	65125903	missense	possibly damaging	0.90
R5745:Cobll1	UTSW	2	65098457	missense	probably damaging	0.99
R5777:Cobll1	UTSW	2	65103268	missense	probably benign	0.27
R6303:Cobll1	UTSW	2	65098033	missense	possibly damaging	0.68
R6471:Cobll1	UTSW	2	65107884	missense	probably damaging	1.00
R7027:Cobll1	UTSW	2	65089503	missense	probably benign	0.00
R7132:Cobll1	UTSW	2	65133768	missense	probably damaging	1.00
R7197:Cobll1	UTSW	2	65098538	missense	probably benign	0.00
R7365:Cobll1	UTSW	2	65098373	missense	probably damaging	0.99
R7607:Cobll1	UTSW	2	65095857	missense	probably benign	0.02
R7899:Cobll1	UTSW	2	65125931	missense	probably damaging	1.00
R7982:Cobll1	UTSW	2	65125931	missense	probably damaging	1.00
X0020:Cobll1	UTSW	2	65103322	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCTTGCCAGTAACTATTCTACTG -3'
(R):5'- TCTTTCACGAGGTCCAACAC -3'

Sequencing Primer
(F):5'- TGGTTACAAGCCACCATGTG -3'
(R):5'- ACCATTTCCAAACCGTACATTTC -3'

Posted On

2016-06-06