Incidental Mutation 'R5100:Ncoa5'
ID388205
Institutional Source Beutler Lab
Gene Symbol Ncoa5
Ensembl Gene ENSMUSG00000039804
Gene Namenuclear receptor coactivator 5
Synonyms
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165000357-165034867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165009389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 188 (I188T)
Ref Sequence ENSEMBL: ENSMUSP00000046388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000153905]
Predicted Effect probably damaging
Transcript: ENSMUST00000040381
AA Change: I188T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122070
AA Change: I188T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804
AA Change: I188T

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127545
Predicted Effect probably benign
Transcript: ENSMUST00000153905
SMART Domains Protein: ENSMUSP00000116778
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Male mice heterozygous for a knock-out allele exhibit infertility, impaired glucose homeostasis, liver dysplasia and HCC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Ncoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02285:Ncoa5 APN 2 165002840 missense probably damaging 1.00
IGL02624:Ncoa5 APN 2 165013061 missense probably damaging 0.99
R0383:Ncoa5 UTSW 2 165009390 missense possibly damaging 0.67
R0835:Ncoa5 UTSW 2 165002794 missense probably damaging 1.00
R1667:Ncoa5 UTSW 2 165001703 missense probably damaging 1.00
R2110:Ncoa5 UTSW 2 165012918 missense possibly damaging 0.59
R4887:Ncoa5 UTSW 2 165002150 missense probably damaging 1.00
R5631:Ncoa5 UTSW 2 165013121 missense possibly damaging 0.90
R6616:Ncoa5 UTSW 2 165010563 nonsense probably null
R6737:Ncoa5 UTSW 2 165002135 missense probably damaging 1.00
R7015:Ncoa5 UTSW 2 165002081 missense probably benign 0.02
R7567:Ncoa5 UTSW 2 165004251 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTAGGCTCAGATAATAACAGTGGGG -3'
(R):5'- AAGCATTACAGTGGCTGTGG -3'

Sequencing Primer
(F):5'- TAACAGTGGGGCAGCCAAGTC -3'
(R):5'- CACCCAAGGTTTTATCTTGATGG -3'
Posted On2016-06-06