Incidental Mutation 'R5100:Wnt5b'
ID388214
Institutional Source Beutler Lab
Gene Symbol Wnt5b
Ensembl Gene ENSMUSG00000030170
Gene Namewingless-type MMTV integration site family, member 5B
SynonymsWnt-5b
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5100 (G1)
Quality Score203
Status Not validated
Chromosome6
Chromosomal Location119432531-119544347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119440488 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 139 (S139A)
Ref Sequence ENSEMBL: ENSMUSP00000137065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]
Predicted Effect probably benign
Transcript: ENSMUST00000117171
AA Change: S139A

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: S139A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118120
AA Change: S101A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: S101A

DomainStartEndE-ValueType
WNT1 12 321 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119369
AA Change: S152A

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: S152A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178696
AA Change: S139A

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: S139A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Wnt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Wnt5b APN 6 119440554 missense possibly damaging 0.70
IGL01822:Wnt5b APN 6 119433472 missense probably damaging 1.00
luftmensch UTSW 6 119433852 missense probably damaging 0.97
R0557:Wnt5b UTSW 6 119433818 missense probably damaging 1.00
R0732:Wnt5b UTSW 6 119446582 nonsense probably null
R1472:Wnt5b UTSW 6 119433481 missense probably damaging 1.00
R1673:Wnt5b UTSW 6 119446354 missense probably benign 0.19
R4202:Wnt5b UTSW 6 119440311 missense probably damaging 1.00
R5264:Wnt5b UTSW 6 119433852 missense probably damaging 0.97
R5393:Wnt5b UTSW 6 119440433 missense probably damaging 1.00
R5394:Wnt5b UTSW 6 119440322 missense probably damaging 0.98
R5482:Wnt5b UTSW 6 119446431 missense probably benign 0.19
R5741:Wnt5b UTSW 6 119433729 missense probably damaging 1.00
R5902:Wnt5b UTSW 6 119448238 missense probably benign 0.00
R6005:Wnt5b UTSW 6 119433654 missense probably benign 0.04
R6061:Wnt5b UTSW 6 119433642 missense probably damaging 0.98
R6208:Wnt5b UTSW 6 119446512 missense probably damaging 1.00
R6405:Wnt5b UTSW 6 119433496 missense probably benign 0.06
R6478:Wnt5b UTSW 6 119433790 missense probably damaging 1.00
R6482:Wnt5b UTSW 6 119433612 missense possibly damaging 0.88
R7047:Wnt5b UTSW 6 119448256 start gained probably benign
R7338:Wnt5b UTSW 6 119448131 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAGGTTCATGAGAGCTCGGC -3'
(R):5'- CACAGCACAGGGTTTCTAAGC -3'

Sequencing Primer
(F):5'- ATGAGAGCTCGGCCCTGC -3'
(R):5'- GGGTTTCTAAGCCTCGGC -3'
Posted On2016-06-06