Incidental Mutation 'R5100:Mfge8'
ID388217
Institutional Source Beutler Lab
Gene Symbol Mfge8
Ensembl Gene ENSMUSG00000030605
Gene Namemilk fat globule-EGF factor 8 protein
SynonymsMFG-E8, Mfgm, EGF/factor VIII, lactadherin, SED1
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5100 (G1)
Quality Score167
Status Not validated
Chromosome7
Chromosomal Location79133768-79149060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79143300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 139 (D139E)
Ref Sequence ENSEMBL: ENSMUSP00000032825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032825] [ENSMUST00000107409] [ENSMUST00000205563]
PDB Structure
NMR Structure of the Mouse MFG-E8 C2 Domain [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032825
AA Change: D139E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032825
Gene: ENSMUSG00000030605
AA Change: D139E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
low complexity region 123 138 N/A INTRINSIC
FA58C 147 303 1.94e-43 SMART
FA58C 307 463 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107409
SMART Domains Protein: ENSMUSP00000103032
Gene: ENSMUSG00000030605

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
FA58C 110 266 3.68e-44 SMART
FA58C 270 426 1.24e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205526
Predicted Effect probably benign
Transcript: ENSMUST00000205563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206844
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility associated with impaired zona pellucida binding. Fertility is unaffected in female mutant mice. Splenomegaly occurs with age and defects occur in phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Mfge8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Mfge8 APN 7 79136782 missense probably damaging 1.00
IGL01751:Mfge8 APN 7 79136655 critical splice donor site probably null
IGL02023:Mfge8 APN 7 79145237 intron probably benign
IGL02112:Mfge8 APN 7 79143340 missense probably benign
IGL02669:Mfge8 APN 7 79145681 missense probably benign 0.36
IGL02978:Mfge8 APN 7 79141710 missense probably damaging 1.00
IGL02978:Mfge8 APN 7 79141728 missense possibly damaging 0.92
R1587:Mfge8 UTSW 7 79134765 missense probably damaging 1.00
R1657:Mfge8 UTSW 7 79141773 missense probably benign
R1716:Mfge8 UTSW 7 79142443 missense probably damaging 1.00
R4766:Mfge8 UTSW 7 79134525 missense probably damaging 1.00
R6932:Mfge8 UTSW 7 79143301 missense probably benign
R7044:Mfge8 UTSW 7 79142520 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AACAACGTGGCCTCTGATGAG -3'
(R):5'- GACGAAAAGCCTGCTTTGTGTG -3'

Sequencing Primer
(F):5'- CTCTGATGAGGACCTAGAGACAG -3'
(R):5'- GTACTGTCCAAGGCCACTCTG -3'
Posted On2016-06-06