Incidental Mutation 'R5100:Arhgef17'
ID388219
Institutional Source Beutler Lab
Gene Symbol Arhgef17
Ensembl Gene ENSMUSG00000032875
Gene NameRho guanine nucleotide exchange factor (GEF) 17
Synonyms
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5100 (G1)
Quality Score135
Status Not validated
Chromosome7
Chromosomal Location100869752-100932107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100881756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1374 (D1374E)
Ref Sequence ENSEMBL: ENSMUSP00000102647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107032
AA Change: D1374E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: D1374E

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 227 255 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 507 526 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
RhoGEF 1063 1246 9.56e-61 SMART
Blast:PH 1281 1466 4e-88 BLAST
low complexity region 1582 1595 N/A INTRINSIC
low complexity region 1630 1642 N/A INTRINSIC
low complexity region 1646 1657 N/A INTRINSIC
low complexity region 1661 1701 N/A INTRINSIC
low complexity region 1708 1719 N/A INTRINSIC
low complexity region 2033 2040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175555
Predicted Effect probably benign
Transcript: ENSMUST00000208482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208735
Predicted Effect possibly damaging
Transcript: ENSMUST00000209041
AA Change: D365E

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Arhgef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Arhgef17 APN 7 100929449 missense probably benign
IGL01071:Arhgef17 APN 7 100885700 missense probably damaging 0.99
IGL01882:Arhgef17 APN 7 100878580 nonsense probably null
IGL01995:Arhgef17 APN 7 100928655 missense probably benign 0.02
IGL02213:Arhgef17 APN 7 100890426 missense probably benign
IGL02380:Arhgef17 APN 7 100929443 missense possibly damaging 0.60
IGL02551:Arhgef17 APN 7 100930346 missense probably damaging 1.00
IGL02613:Arhgef17 APN 7 100928896 missense probably damaging 1.00
IGL02643:Arhgef17 APN 7 100883882 missense possibly damaging 0.95
IGL02798:Arhgef17 APN 7 100929626 missense probably benign 0.00
IGL03113:Arhgef17 APN 7 100929731 missense probably benign 0.00
IGL03264:Arhgef17 APN 7 100880013 missense probably benign 0.00
R0064:Arhgef17 UTSW 7 100881354 missense probably benign 0.00
R0189:Arhgef17 UTSW 7 100928850 missense probably damaging 1.00
R0482:Arhgef17 UTSW 7 100880621 missense probably damaging 1.00
R0826:Arhgef17 UTSW 7 100930743 missense probably benign 0.01
R1295:Arhgef17 UTSW 7 100881269 nonsense probably null
R1296:Arhgef17 UTSW 7 100881269 nonsense probably null
R1389:Arhgef17 UTSW 7 100931037 small deletion probably benign
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1513:Arhgef17 UTSW 7 100930862 missense probably benign
R1539:Arhgef17 UTSW 7 100890473 missense probably damaging 1.00
R1644:Arhgef17 UTSW 7 100929504 missense probably damaging 1.00
R1789:Arhgef17 UTSW 7 100929870 missense probably damaging 1.00
R1861:Arhgef17 UTSW 7 100882268 missense probably damaging 1.00
R1868:Arhgef17 UTSW 7 100878977 missense probably benign
R2009:Arhgef17 UTSW 7 100881781 missense probably damaging 0.98
R2095:Arhgef17 UTSW 7 100881263 missense probably damaging 1.00
R2311:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
R3607:Arhgef17 UTSW 7 100931172 missense probably damaging 1.00
R3882:Arhgef17 UTSW 7 100876454 missense possibly damaging 0.70
R4089:Arhgef17 UTSW 7 100883799 missense probably damaging 1.00
R4420:Arhgef17 UTSW 7 100882308 splice site probably benign
R4536:Arhgef17 UTSW 7 100929854 missense probably damaging 1.00
R4548:Arhgef17 UTSW 7 100931129 missense possibly damaging 0.60
R4616:Arhgef17 UTSW 7 100882485 missense probably damaging 1.00
R5040:Arhgef17 UTSW 7 100876825 missense probably benign 0.17
R5233:Arhgef17 UTSW 7 100881369 missense possibly damaging 0.61
R5307:Arhgef17 UTSW 7 100929428 missense probably benign 0.00
R5313:Arhgef17 UTSW 7 100928924 missense probably damaging 0.99
R5643:Arhgef17 UTSW 7 100880011 missense probably damaging 1.00
R5704:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6166:Arhgef17 UTSW 7 100876492 missense probably damaging 1.00
R6417:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6420:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6510:Arhgef17 UTSW 7 100878536 missense probably damaging 0.97
R6877:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6888:Arhgef17 UTSW 7 100930820 missense possibly damaging 0.74
R7016:Arhgef17 UTSW 7 100878977 missense probably benign
R7073:Arhgef17 UTSW 7 100929991 nonsense probably null
R7322:Arhgef17 UTSW 7 100877797 missense probably benign 0.01
R7691:Arhgef17 UTSW 7 100929642 missense probably damaging 1.00
R7724:Arhgef17 UTSW 7 100880609 missense probably damaging 1.00
R7728:Arhgef17 UTSW 7 100930068 missense probably benign 0.00
R7829:Arhgef17 UTSW 7 100876845 missense probably benign 0.03
X0012:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCCTTCAGATAAGTGACAGGACC -3'
(R):5'- TCTGAGAGCTACCTGTTGACC -3'

Sequencing Primer
(F):5'- CTTCAGATAAGTGACAGGACCAACTG -3'
(R):5'- GTCTGGAAGTGCTCCCATTTGC -3'
Posted On2016-06-06