Mutagenetix > Incidental Mutations

Incidental Mutation 'R5100:Kif15'

388223

Institutional Source

Beutler Lab

Gene Symbol

Kif15

Ensembl Gene

ENSMUSG00000036768

Gene Name

kinesin family member 15

Synonyms

HKLP2, Knsl7, N-10 kinesin

MMRRC Submission

042689-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5100 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122951046-123018733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122991994 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 655 (T655A)

Ref Sequence

ENSEMBL: ENSMUSP00000035490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000214652]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040717
AA Change: T655A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: T655A

Domain	Start	End	E-Value	Type
KISc	24	371	2.86e-179	SMART
Pfam:Kinesin-relat_1	463	551	6.6e-26	PFAM
coiled coil region	579	643	N/A	INTRINSIC
coiled coil region	706	1037	N/A	INTRINSIC
coiled coil region	1065	1133	N/A	INTRINSIC
Pfam:HMMR_C	1265	1387	3.5e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214183

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214652
AA Change: T427A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216491

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217415

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	T	11: 72,166,651	M774K	probably damaging	Het
Adamts3	G	A	5: 89,708,643	T357I	probably damaging	Het
Ap3m2	T	A	8: 22,789,388	M408L	probably benign	Het
Apaf1	A	T	10: 90,997,287	N1116K	probably benign	Het
Arhgap31	A	T	16: 38,601,459	I1415N	probably damaging	Het
Arhgef17	A	T	7: 100,881,756	D1374E	possibly damaging	Het
Asxl1	C	G	2: 153,397,931	N546K	probably damaging	Het
Cobll1	T	A	2: 65,125,901	T337S	probably benign	Het
Depdc1a	A	T	3: 159,515,520	I163L	probably benign	Het
Flrt3	T	A	2: 140,671,384		probably null	Het
Foxn4	A	T	5: 114,256,759	L369H	possibly damaging	Het
Gm11992	T	C	11: 9,061,290	S244P	probably damaging	Het
Gm14412	C	T	2: 177,315,115	C329Y	probably damaging	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm5113	G	A	7: 30,178,651	V55M	probably damaging	Het
Grhl3	A	G	4: 135,542,675	I599T	probably benign	Het
H2-Q6	G	C	17: 35,425,320	E93Q	probably benign	Het
Hk3	T	C	13: 55,009,030	T570A	probably damaging	Het
Hspb8	T	C	5: 116,415,409	I143M	probably damaging	Het
Lpin2	G	A	17: 71,243,970	W708*	probably null	Het
Lrit1	T	A	14: 37,062,214	C500S	possibly damaging	Het
Macf1	A	C	4: 123,474,468	C602G	probably benign	Het
Mesd	C	T	7: 83,897,769	R147C	probably damaging	Het
Mfge8	A	T	7: 79,143,300	D139E	probably benign	Het
Ncoa3	G	A	2: 166,050,097	R131Q	probably damaging	Het
Ncoa5	A	G	2: 165,009,389	I188T	probably damaging	Het
Ngp	T	C	9: 110,420,001	L47P	probably damaging	Het
Nhlrc1	T	C	13: 47,014,421	H120R	probably benign	Het
Otos	T	A	1: 92,644,385	H73L	probably damaging	Het
Pcsk5	C	T	19: 17,515,135		probably null	Het
Phc3	T	C	3: 30,922,199	E740G	possibly damaging	Het
Pla2g7	T	C	17: 43,611,376	L382P	probably damaging	Het
Plcd3	C	A	11: 103,078,349	R264L	probably benign	Het
Pms2	A	G	5: 143,928,188	D696G	probably damaging	Het
Ptchd4	A	T	17: 42,503,676	I823F	possibly damaging	Het
Scn9a	T	C	2: 66,534,119	R828G	probably damaging	Het
Spred2	T	A	11: 20,021,291	C386*	probably null	Het
Terb1	A	T	8: 104,495,173	L165*	probably null	Het
Tgm2	A	T	2: 158,127,164	S430R	probably benign	Het
Tnxb	A	T	17: 34,710,928	I2879F	probably damaging	Het
Trpm3	T	G	19: 22,918,766	V977G	probably damaging	Het
Wnt5b	A	C	6: 119,440,488	S139A	probably benign	Het
Zfp820	C	A	17: 21,821,073	V52L	possibly damaging	Het
Zfyve26	T	A	12: 79,280,058	R764*	probably null	Het

Other mutations in Kif15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01459:Kif15	APN	9	122975755	missense	probably damaging	1.00
IGL01577:Kif15	APN	9	122996334	missense	probably benign	0.06
IGL01647:Kif15	APN	9	122963471	intron	probably benign
IGL01921:Kif15	APN	9	122979504	missense	probably damaging	1.00
IGL02040:Kif15	APN	9	123017385	missense	probably damaging	0.99
IGL02191:Kif15	APN	9	122975679	missense	probably damaging	1.00
IGL02218:Kif15	APN	9	122995827	splice site	probably benign
IGL02537:Kif15	APN	9	122993849	missense	probably benign	0.08
IGL02814:Kif15	APN	9	123003640	missense	possibly damaging	0.83
PIT4480001:Kif15	UTSW	9	123011543	missense	probably benign
R0034:Kif15	UTSW	9	122999285	missense	possibly damaging	0.47
R0458:Kif15	UTSW	9	123009359	missense	probably benign
R0526:Kif15	UTSW	9	122997797	missense	probably damaging	0.96
R0533:Kif15	UTSW	9	123009433	unclassified	probably benign
R0726:Kif15	UTSW	9	122959928	missense	probably benign	0.21
R1580:Kif15	UTSW	9	122959956	missense	probably benign	0.22
R1597:Kif15	UTSW	9	122994009	missense	probably benign	0.22
R2096:Kif15	UTSW	9	122986187	missense	probably damaging	1.00
R3125:Kif15	UTSW	9	122987961	missense	probably damaging	0.99
R3176:Kif15	UTSW	9	122987840	splice site	probably benign
R4088:Kif15	UTSW	9	122986189	missense	probably benign	0.29
R4308:Kif15	UTSW	9	123013982	missense	probably benign	0.00
R4597:Kif15	UTSW	9	122993849	missense	probably benign	0.08
R4705:Kif15	UTSW	9	122959993	splice site	probably null
R4832:Kif15	UTSW	9	123002126	splice site	probably null
R5126:Kif15	UTSW	9	122975758	missense	probably damaging	1.00
R5180:Kif15	UTSW	9	122999210	missense	probably damaging	0.99
R5247:Kif15	UTSW	9	122986442	missense	possibly damaging	0.65
R5376:Kif15	UTSW	9	122993971	missense	probably benign	0.04
R5392:Kif15	UTSW	9	122996295	missense	probably damaging	0.99
R5422:Kif15	UTSW	9	122984889	synonymous	probably null
R5562:Kif15	UTSW	9	122978016	missense	probably damaging	1.00
R5663:Kif15	UTSW	9	122991851	splice site	probably null
R5767:Kif15	UTSW	9	123013974	missense	possibly damaging	0.78
R5927:Kif15	UTSW	9	123017261	missense	probably benign	0.00
R6049:Kif15	UTSW	9	123011622	missense	probably damaging	0.98
R6435:Kif15	UTSW	9	122986491	missense	probably damaging	1.00
R7040:Kif15	UTSW	9	123011614	missense	possibly damaging	0.67
R7158:Kif15	UTSW	9	122999314	missense	probably benign
R7163:Kif15	UTSW	9	123017657	missense	probably damaging	1.00
R7197:Kif15	UTSW	9	123009926	critical splice donor site	probably null
R7318:Kif15	UTSW	9	122987949	missense	probably damaging	1.00
R7360:Kif15	UTSW	9	122991137	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACTCAAAAGCCAAATCACATGTG -3'
(R):5'- AGCACTGTCTAAAGTTCATGACG -3'

Sequencing Primer
(F):5'- GCTTAACATTCCTCACTACCTGAAGG -3'
(R):5'- TCATGACGAAACAGAATTTGATCCC -3'

Posted On

2016-06-06