Incidental Mutation 'R5100:Nhlrc1'
ID388232
Institutional Source Beutler Lab
Gene Symbol Nhlrc1
Ensembl Gene ENSMUSG00000044231
Gene NameNHL repeat containing 1
SynonymsMalin, EPM2B, B230309E09Rik
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5100 (G1)
Quality Score106
Status Not validated
Chromosome13
Chromosomal Location47012557-47014850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47014421 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 120 (H120R)
Ref Sequence ENSEMBL: ENSMUSP00000054990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052747]
Predicted Effect probably benign
Transcript: ENSMUST00000052747
AA Change: H120R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054990
Gene: ENSMUSG00000044231
AA Change: H120R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 28 73 1.45e-6 SMART
low complexity region 89 99 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
internal_repeat_1 128 245 5.99e-5 PROSPERO
internal_repeat_1 263 394 5.99e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000060680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225443
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of Lafora bodies and total glycogen levels in the heart muscle, skeletal muscle, and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Nhlrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Nhlrc1 APN 13 47014131 missense probably damaging 0.97
IGL01759:Nhlrc1 APN 13 47013962 missense probably benign 0.00
R1540:Nhlrc1 UTSW 13 47014344 missense probably damaging 1.00
R2116:Nhlrc1 UTSW 13 47014185 missense probably benign 0.00
R4243:Nhlrc1 UTSW 13 47014026 missense probably benign 0.06
R4563:Nhlrc1 UTSW 13 47014190 missense possibly damaging 0.67
R4975:Nhlrc1 UTSW 13 47013740 missense probably benign 0.28
R5671:Nhlrc1 UTSW 13 47013717 missense probably benign 0.06
R5770:Nhlrc1 UTSW 13 47014712 missense probably benign 0.22
R6476:Nhlrc1 UTSW 13 47014181 missense possibly damaging 0.95
R6886:Nhlrc1 UTSW 13 47013776 missense possibly damaging 0.94
R7223:Nhlrc1 UTSW 13 47014208 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCAAACACTTTGAGGGAGCAGTC -3'
(R):5'- CAAGGTGTGCTTCGAGAGGTTC -3'

Sequencing Primer
(F):5'- ACATCCAGTGGGTACTTCACG -3'
(R):5'- AGAGGTTCGGCCACTGG -3'
Posted On2016-06-06