Incidental Mutation 'R5100:Zfp820'
ID388237
Institutional Source Beutler Lab
Gene Symbol Zfp820
Ensembl Gene ENSMUSG00000069743
Gene Namezinc finger protein 820
Synonyms2610036F08Rik
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21816876-21845759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21821073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 52 (V52L)
Ref Sequence ENSEMBL: ENSMUSP00000081158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084141
AA Change: V52L

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081158
Gene: ENSMUSG00000069743
AA Change: V52L

DomainStartEndE-ValueType
KRAB 13 73 8.77e-20 SMART
ZnF_C2H2 183 205 6.32e-3 SMART
ZnF_C2H2 211 233 2.79e-4 SMART
ZnF_C2H2 239 261 4.3e-5 SMART
ZnF_C2H2 267 289 4.61e-5 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 1.22e-4 SMART
ZnF_C2H2 351 373 2.75e-3 SMART
ZnF_C2H2 379 401 2.95e-3 SMART
ZnF_C2H2 407 429 5.29e-5 SMART
ZnF_C2H2 435 457 1.42e-5 SMART
ZnF_C2H2 463 485 1.2e-3 SMART
ZnF_C2H2 491 513 1.13e-4 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Zfp820
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Zfp820 APN 17 21819311 missense probably damaging 1.00
IGL00954:Zfp820 APN 17 21819879 missense probably damaging 1.00
IGL01088:Zfp820 APN 17 21821181 nonsense probably null
IGL03067:Zfp820 APN 17 21819820 missense possibly damaging 0.68
R0158:Zfp820 UTSW 17 21819819 missense probably benign 0.06
R0617:Zfp820 UTSW 17 21819704 missense probably damaging 0.99
R0658:Zfp820 UTSW 17 21818920 missense probably benign 0.00
R0696:Zfp820 UTSW 17 21820060 missense possibly damaging 0.94
R0791:Zfp820 UTSW 17 21819528 missense probably benign 0.05
R0792:Zfp820 UTSW 17 21819528 missense probably benign 0.05
R0882:Zfp820 UTSW 17 21823836 splice site probably benign
R1421:Zfp820 UTSW 17 21819880 missense possibly damaging 0.85
R1573:Zfp820 UTSW 17 21818756 missense probably benign 0.00
R1928:Zfp820 UTSW 17 21819335 missense probably benign 0.00
R3889:Zfp820 UTSW 17 21818896 missense probably benign 0.25
R4782:Zfp820 UTSW 17 21818985 missense probably benign 0.00
R4799:Zfp820 UTSW 17 21818985 missense probably benign 0.00
R4807:Zfp820 UTSW 17 21823872 start codon destroyed probably null 1.00
R4913:Zfp820 UTSW 17 21819219 missense probably benign 0.42
R5766:Zfp820 UTSW 17 21820002 missense probably damaging 0.96
R5772:Zfp820 UTSW 17 21818721 missense probably damaging 1.00
R6516:Zfp820 UTSW 17 21819373 missense probably damaging 1.00
R6577:Zfp820 UTSW 17 21819403 missense probably benign 0.00
R7094:Zfp820 UTSW 17 21819265 missense probably benign 0.41
R7570:Zfp820 UTSW 17 21819013 missense probably benign 0.14
R7794:Zfp820 UTSW 17 21820128 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACCACTGGATCCTCTTCTAAAG -3'
(R):5'- CACAATGTGCCTCTTATTCTTTAGG -3'

Sequencing Primer
(F):5'- CCACTGGATCCTCTTCTAAAGAATGG -3'
(R):5'- ATCCAGGAAAACACTTTTGTCCAGG -3'
Posted On2016-06-06