Incidental Mutation 'R5100:Pla2g7'
ID388241
Institutional Source Beutler Lab
Gene Symbol Pla2g7
Ensembl Gene ENSMUSG00000023913
Gene Namephospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
SynonymsPAF acetylhydrolase
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43568098-43612201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43611376 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 382 (L382P)
Ref Sequence ENSEMBL: ENSMUSP00000024706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024706] [ENSMUST00000045717] [ENSMUST00000168073] [ENSMUST00000169694]
Predicted Effect probably damaging
Transcript: ENSMUST00000024706
AA Change: L382P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024706
Gene: ENSMUSG00000023913
AA Change: L382P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 415 6e-179 PFAM
Pfam:Abhydrolase_5 145 351 3.2e-18 PFAM
Pfam:Abhydrolase_1 215 318 2.8e-7 PFAM
Pfam:Peptidase_S9 247 356 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045717
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163489
Predicted Effect probably benign
Transcript: ENSMUST00000168073
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169694
SMART Domains Protein: ENSMUSP00000132027
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 298 6.1e-120 PFAM
Pfam:Abhydrolase_5 145 298 1.4e-15 PFAM
Pfam:Abhydrolase_6 146 298 4.5e-11 PFAM
Pfam:Peptidase_S9 246 298 4.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted enzyme that catalyzes the degradation of platelet-activating factor to biologically inactive products. Defects in this gene are a cause of platelet-activating factor acetylhydrolase deficiency. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced early mortality in response to bacterial exposure, formula feeding and asphyxia, but survivors show a significantly higher incidence of necrotizing enterocolitis relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lpin2 G A 17: 71,243,970 W708* probably null Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Pla2g7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pla2g7 APN 17 43602871 missense probably damaging 1.00
R0026:Pla2g7 UTSW 17 43594930 splice site probably benign
R0421:Pla2g7 UTSW 17 43611412 missense probably damaging 0.96
R1701:Pla2g7 UTSW 17 43600524 missense probably damaging 1.00
R4591:Pla2g7 UTSW 17 43600559 missense probably damaging 0.98
R5713:Pla2g7 UTSW 17 43594292 missense probably benign 0.03
R6404:Pla2g7 UTSW 17 43594797 missense probably damaging 1.00
R6433:Pla2g7 UTSW 17 43599126 missense probably damaging 1.00
R7180:Pla2g7 UTSW 17 43599076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTTGACCCTCAGCTAC -3'
(R):5'- TTAATGCAAGGCCACATACTCC -3'

Sequencing Primer
(F):5'- TGACCCTCAGCTACATTAAAATGATC -3'
(R):5'- GGCCACATACTCCTCTTTTTGAAATG -3'
Posted On2016-06-06