Incidental Mutation 'R5100:Lpin2'
ID388242
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission 042689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R5100 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 71243970 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 708 (W708*)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably null
Transcript: ENSMUST00000126681
AA Change: W746*
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: W746*

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129635
AA Change: W708*
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: W708*

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140150
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,651 M774K probably damaging Het
Adamts3 G A 5: 89,708,643 T357I probably damaging Het
Ap3m2 T A 8: 22,789,388 M408L probably benign Het
Apaf1 A T 10: 90,997,287 N1116K probably benign Het
Arhgap31 A T 16: 38,601,459 I1415N probably damaging Het
Arhgef17 A T 7: 100,881,756 D1374E possibly damaging Het
Asxl1 C G 2: 153,397,931 N546K probably damaging Het
Cobll1 T A 2: 65,125,901 T337S probably benign Het
Depdc1a A T 3: 159,515,520 I163L probably benign Het
Flrt3 T A 2: 140,671,384 probably null Het
Foxn4 A T 5: 114,256,759 L369H possibly damaging Het
Gm11992 T C 11: 9,061,290 S244P probably damaging Het
Gm14412 C T 2: 177,315,115 C329Y probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5113 G A 7: 30,178,651 V55M probably damaging Het
Grhl3 A G 4: 135,542,675 I599T probably benign Het
H2-Q6 G C 17: 35,425,320 E93Q probably benign Het
Hk3 T C 13: 55,009,030 T570A probably damaging Het
Hspb8 T C 5: 116,415,409 I143M probably damaging Het
Kif15 A G 9: 122,991,994 T655A probably damaging Het
Lrit1 T A 14: 37,062,214 C500S possibly damaging Het
Macf1 A C 4: 123,474,468 C602G probably benign Het
Mesd C T 7: 83,897,769 R147C probably damaging Het
Mfge8 A T 7: 79,143,300 D139E probably benign Het
Ncoa3 G A 2: 166,050,097 R131Q probably damaging Het
Ncoa5 A G 2: 165,009,389 I188T probably damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nhlrc1 T C 13: 47,014,421 H120R probably benign Het
Otos T A 1: 92,644,385 H73L probably damaging Het
Pcsk5 C T 19: 17,515,135 probably null Het
Phc3 T C 3: 30,922,199 E740G possibly damaging Het
Pla2g7 T C 17: 43,611,376 L382P probably damaging Het
Plcd3 C A 11: 103,078,349 R264L probably benign Het
Pms2 A G 5: 143,928,188 D696G probably damaging Het
Ptchd4 A T 17: 42,503,676 I823F possibly damaging Het
Scn9a T C 2: 66,534,119 R828G probably damaging Het
Spred2 T A 11: 20,021,291 C386* probably null Het
Terb1 A T 8: 104,495,173 L165* probably null Het
Tgm2 A T 2: 158,127,164 S430R probably benign Het
Tnxb A T 17: 34,710,928 I2879F probably damaging Het
Trpm3 T G 19: 22,918,766 V977G probably damaging Het
Wnt5b A C 6: 119,440,488 S139A probably benign Het
Zfp820 C A 17: 21,821,073 V52L possibly damaging Het
Zfyve26 T A 12: 79,280,058 R764* probably null Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R7923:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R8011:Lpin2 UTSW 17 71230375 missense probably benign 0.43
Z1176:Lpin2 UTSW 17 71225211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTACAAGGCTGCCTTTTGG -3'
(R):5'- AAACTGATAGGATACCAAGCACATG -3'

Sequencing Primer
(F):5'- GGCTGTATAAAATCAGGATAAACCC -3'
(R):5'- GCTTGAACACAAAGCTACAAATATG -3'
Posted On2016-06-06