Incidental Mutation 'R5064:Nasp'
ID388253
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5064 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 116611970 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]
Predicted Effect probably null
Transcript: ENSMUST00000030456
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030457
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081182
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154811
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Ascl2 T C 7: 142,968,259 N151D possibly damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mllt6 C A 11: 97,673,949 A527E probably damaging Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Plppr1 A T 4: 49,319,974 H200L probably benign Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn1r55 A T 7: 5,146,929 M165K probably benign Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Vta1 G T 10: 14,705,478 probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1707:Nasp UTSW 4 116618936 missense probably damaging 0.99
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R4983:Nasp UTSW 4 116602185 missense probably damaging 0.99
R5687:Nasp UTSW 4 116605805 intron probably benign
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6145:Nasp UTSW 4 116611077 missense probably benign 0.19
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6483:Nasp UTSW 4 116618948 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
R8166:Nasp UTSW 4 116610915 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAGGACTCCTAATAACTGAGTATGG -3'
(R):5'- ACTTCCCAGGGCCAGAATTC -3'

Sequencing Primer
(F):5'- CTGCATCAGCCCAAGTAT -3'
(R):5'- ACGGAAATCAGGTCCTCTTG -3'
Posted On2016-06-06