Incidental Mutation 'R5064:Vmn1r55'
ID388258
Institutional Source Beutler Lab
Gene Symbol Vmn1r55
Ensembl Gene ENSMUSG00000074402
Gene Namevomeronasal 1 receptor 55
SynonymsLOC236535, LOC384522, V1rd5
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5146218-5147501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5146929 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 165 (M165K)
Ref Sequence ENSEMBL: ENSMUSP00000096443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098844]
Predicted Effect probably benign
Transcript: ENSMUST00000098844
AA Change: M165K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096443
Gene: ENSMUSG00000074402
AA Change: M165K

DomainStartEndE-ValueType
Pfam:TAS2R 1 286 3.7e-14 PFAM
Pfam:7tm_1 20 279 4e-8 PFAM
Pfam:V1R 31 286 5.5e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Ascl2 T C 7: 142,968,259 N151D possibly damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mllt6 C A 11: 97,673,949 A527E probably damaging Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nasp A G 4: 116,611,970 probably null Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Plppr1 A T 4: 49,319,974 H200L probably benign Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Vta1 G T 10: 14,705,478 probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Vmn1r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1771:Vmn1r55 UTSW 7 5146920 missense probably benign 0.01
R2063:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2064:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2066:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2068:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R3737:Vmn1r55 UTSW 7 5147196 missense probably damaging 0.99
R4409:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4410:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4700:Vmn1r55 UTSW 7 5146587 missense probably damaging 1.00
R4700:Vmn1r55 UTSW 7 5146588 missense probably damaging 0.98
R4755:Vmn1r55 UTSW 7 5147026 missense probably damaging 1.00
R4945:Vmn1r55 UTSW 7 5147106 missense probably damaging 1.00
R5186:Vmn1r55 UTSW 7 5146986 missense probably damaging 0.99
R5394:Vmn1r55 UTSW 7 5146996 missense probably damaging 1.00
R6487:Vmn1r55 UTSW 7 5146555 missense probably benign 0.23
R7855:Vmn1r55 UTSW 7 5146624 missense probably benign
R7938:Vmn1r55 UTSW 7 5146624 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGCATGGCCTCTGTTG -3'
(R):5'- GGCACAAACATGTGTTCTACC -3'

Sequencing Primer
(F):5'- CAGCATGGCCTCTGTTGCTTTG -3'
(R):5'- GCACAAACATGTGTTCTACCTGTGTC -3'
Posted On2016-06-06