Mutagenetix > Incidental Mutation

Incidental Mutation 'R5064:Adamts7'

388263

Institutional Source

Beutler Lab

Gene Symbol

Adamts7

Ensembl Gene

ENSMUSG00000032363

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 7

Synonyms

ADAM-TS7

MMRRC Submission

042654-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R5064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90041420-90082155 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90077883 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1496 (Y1496N)

Ref Sequence

ENSEMBL: ENSMUSP00000129292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]

AlphaFold

Q68SA9

Predicted Effect

probably damaging
Transcript: ENSMUST00000113059
AA Change: Y1496N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: Y1496N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	174	1.1e-36	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.3e-16	PFAM
Pfam:Reprolysin_4	224	425	8.5e-9	PFAM
Pfam:Reprolysin	226	437	2.2e-27	PFAM
Pfam:Reprolysin_2	244	427	2.9e-12	PFAM
Pfam:Reprolysin_3	248	383	5.2e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	2.2e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113060
AA Change: Y1454N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: Y1454N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	3.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.6e-16	PFAM
Pfam:Reprolysin_4	224	425	8.2e-9	PFAM
Pfam:Reprolysin	226	437	6.4e-30	PFAM
Pfam:Reprolysin_2	244	427	4.6e-12	PFAM
Pfam:Reprolysin_3	248	383	8.1e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.5e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1343	1393	2.4e-2	SMART
TSP1	1394	1451	1.8e-2	SMART
TSP1	1453	1500	4.82e-2	SMART
TSP1	1501	1558	1.39e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124441

Predicted Effect

probably benign
Transcript: ENSMUST00000134996

SMART Domains

Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.4e-29	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	412	1e-17	PFAM
Pfam:Reprolysin_4	224	426	5e-10	PFAM
Pfam:Reprolysin	226	437	3.7e-31	PFAM
Pfam:Reprolysin_2	244	427	3.2e-13	PFAM
Pfam:Reprolysin_3	248	383	6.3e-14	PFAM
Blast:ACR	439	505	7e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144943

Predicted Effect

probably damaging
Transcript: ENSMUST00000147250
AA Change: Y1395N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: Y1395N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.7e-26	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.4e-14	PFAM
Pfam:Reprolysin_4	224	425	7e-7	PFAM
Pfam:Reprolysin	226	437	4.9e-28	PFAM
Pfam:Reprolysin_2	244	427	5e-10	PFAM
Pfam:Reprolysin_3	248	383	6.5e-11	PFAM
ACR	439	515	1.7e-5	SMART
TSP1	526	578	2.3e-15	SMART
Pfam:ADAM_spacer1	683	794	3.5e-34	PFAM
TSP1	807	863	6.9e-9	SMART
TSP1	866	908	1.2e-3	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1284	1334	1.2e-4	SMART
TSP1	1335	1392	8.7e-5	SMART
TSP1	1394	1441	2.3e-4	SMART
TSP1	1442	1499	6.5e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167122
AA Change: Y1496N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: Y1496N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	1.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	7.2e-17	PFAM
Pfam:Reprolysin_4	224	425	3.6e-9	PFAM
Pfam:Reprolysin	226	437	2.9e-30	PFAM
Pfam:Reprolysin_2	244	427	2.2e-12	PFAM
Pfam:Reprolysin_3	248	383	3.7e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.1e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Meta Mutation Damage Score

0.0992

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.1%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,340,119 (GRCm39)	V1082A	probably damaging	Het
Ascl2	T	C	7: 142,521,996 (GRCm39)	N151D	possibly damaging	Het
Asxl3	G	T	18: 22,649,076 (GRCm39)	S355I	probably benign	Het
Cttnbp2	T	C	6: 18,448,278 (GRCm39)	Q127R	probably damaging	Het
Efhc1	T	A	1: 21,045,187 (GRCm39)	I401N	possibly damaging	Het
Eml6	C	T	11: 29,699,300 (GRCm39)	V1818I	probably benign	Het
Grin1	G	T	2: 25,193,843 (GRCm39)		probably benign	Het
Ints2	C	T	11: 86,140,100 (GRCm39)	R244H	probably damaging	Het
Mfng	C	T	15: 78,648,588 (GRCm39)	R163H	probably benign	Het
Mllt6	C	A	11: 97,564,775 (GRCm39)	A527E	probably damaging	Het
Msh5	G	T	17: 35,262,759 (GRCm39)		probably benign	Het
Mypn	T	A	10: 62,959,150 (GRCm39)	D1057V	possibly damaging	Het
Nasp	A	G	4: 116,469,167 (GRCm39)		probably null	Het
Nat8l	T	C	5: 34,154,213 (GRCm39)	V9A	probably damaging	Het
Niban1	A	G	1: 151,565,410 (GRCm39)	I247V	probably benign	Het
Nr1h2	G	A	7: 44,201,073 (GRCm39)	A219V	possibly damaging	Het
Nup155	C	A	15: 8,165,354 (GRCm39)	H663Q	probably damaging	Het
Pikfyve	A	G	1: 65,292,566 (GRCm39)	Y1339C	probably damaging	Het
Plppr1	A	T	4: 49,319,974 (GRCm39)	H200L	probably benign	Het
Por	T	C	5: 135,762,649 (GRCm39)	V421A	probably benign	Het
Pxylp1	T	G	9: 96,736,853 (GRCm39)		probably benign	Het
Serpina3a	G	A	12: 104,082,448 (GRCm39)	V74I	probably benign	Het
Sfxn1	T	C	13: 54,239,588 (GRCm39)	I37T	probably benign	Het
Thsd7a	G	T	6: 12,330,951 (GRCm39)	T1397N	possibly damaging	Het
Tnrc6a	T	C	7: 122,785,946 (GRCm39)		probably null	Het
Vmn1r55	A	T	7: 5,149,928 (GRCm39)	M165K	probably benign	Het
Vmn2r58	A	T	7: 41,486,534 (GRCm39)	M787K	probably damaging	Het
Vta1	G	T	10: 14,581,222 (GRCm39)		probably benign	Het
Wdr87-ps	A	G	7: 29,235,080 (GRCm39)		noncoding transcript	Het
Zfp236	A	G	18: 82,709,701 (GRCm39)		probably null	Het

Other mutations in Adamts7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Adamts7	APN	9	90,076,302 (GRCm39)	missense	possibly damaging	0.71
IGL00673:Adamts7	APN	9	90,075,714 (GRCm39)	missense	possibly damaging	0.78
IGL00902:Adamts7	APN	9	90,070,847 (GRCm39)	critical splice donor site	probably null
IGL01303:Adamts7	APN	9	90,053,787 (GRCm39)	missense	possibly damaging	0.46
IGL01333:Adamts7	APN	9	90,069,032 (GRCm39)	missense	probably damaging	1.00
IGL01431:Adamts7	APN	9	90,089,838 (GRCm39)	missense	possibly damaging	0.89
IGL01595:Adamts7	APN	9	90,075,359 (GRCm39)	missense	probably benign	0.02
IGL02728:Adamts7	APN	9	90,073,880 (GRCm39)	splice site	probably benign
IGL02860:Adamts7	APN	9	90,073,915 (GRCm39)	missense	probably benign
IGL03237:Adamts7	APN	9	90,070,717 (GRCm39)	missense	probably damaging	1.00
PIT4495001:Adamts7	UTSW	9	90,056,675 (GRCm39)	missense	probably damaging	1.00
R0044:Adamts7	UTSW	9	90,053,641 (GRCm39)	missense	possibly damaging	0.58
R0078:Adamts7	UTSW	9	90,061,464 (GRCm39)	missense	probably damaging	1.00
R0107:Adamts7	UTSW	9	90,062,773 (GRCm39)	missense	possibly damaging	0.82
R0122:Adamts7	UTSW	9	90,061,474 (GRCm39)	missense	probably damaging	1.00
R0166:Adamts7	UTSW	9	90,075,745 (GRCm39)	missense	probably benign	0.00
R0517:Adamts7	UTSW	9	90,081,911 (GRCm39)	missense	probably benign	0.01
R1442:Adamts7	UTSW	9	90,070,823 (GRCm39)	missense	probably damaging	0.99
R1468:Adamts7	UTSW	9	90,070,851 (GRCm39)	splice site	probably benign
R1554:Adamts7	UTSW	9	90,055,703 (GRCm39)	missense	probably damaging	1.00
R1612:Adamts7	UTSW	9	90,070,750 (GRCm39)	missense	possibly damaging	0.86
R1652:Adamts7	UTSW	9	90,071,697 (GRCm39)	missense	probably damaging	1.00
R2007:Adamts7	UTSW	9	90,059,909 (GRCm39)	missense	probably damaging	1.00
R2091:Adamts7	UTSW	9	90,070,493 (GRCm39)	critical splice donor site	probably null
R2202:Adamts7	UTSW	9	90,062,729 (GRCm39)	missense	probably damaging	1.00
R2204:Adamts7	UTSW	9	90,062,729 (GRCm39)	missense	probably damaging	1.00
R2205:Adamts7	UTSW	9	90,062,729 (GRCm39)	missense	probably damaging	1.00
R2305:Adamts7	UTSW	9	90,062,764 (GRCm39)	missense	probably benign	0.39
R2409:Adamts7	UTSW	9	90,062,740 (GRCm39)	missense	probably damaging	1.00
R4157:Adamts7	UTSW	9	90,070,414 (GRCm39)	missense	probably damaging	1.00
R4210:Adamts7	UTSW	9	90,076,063 (GRCm39)	missense	possibly damaging	0.95
R4368:Adamts7	UTSW	9	90,077,904 (GRCm39)	critical splice donor site	probably null
R4533:Adamts7	UTSW	9	90,062,761 (GRCm39)	missense	probably damaging	1.00
R4608:Adamts7	UTSW	9	90,056,593 (GRCm39)	missense	probably damaging	1.00
R4623:Adamts7	UTSW	9	90,068,515 (GRCm39)	missense	probably benign	0.17
R4661:Adamts7	UTSW	9	90,075,383 (GRCm39)	missense	probably benign	0.02
R4820:Adamts7	UTSW	9	90,071,739 (GRCm39)	missense	possibly damaging	0.62
R4942:Adamts7	UTSW	9	90,045,364 (GRCm39)	missense	probably benign
R4961:Adamts7	UTSW	9	90,067,793 (GRCm39)	missense	probably damaging	1.00
R5763:Adamts7	UTSW	9	90,070,462 (GRCm39)	missense	probably damaging	1.00
R5921:Adamts7	UTSW	9	90,070,747 (GRCm39)	missense	probably benign	0.20
R6027:Adamts7	UTSW	9	90,073,078 (GRCm39)	missense	probably damaging	1.00
R6182:Adamts7	UTSW	9	90,074,489 (GRCm39)	missense	probably benign	0.01
R6306:Adamts7	UTSW	9	90,060,331 (GRCm39)	critical splice donor site	probably null
R6404:Adamts7	UTSW	9	90,062,509 (GRCm39)	splice site	probably null
R6488:Adamts7	UTSW	9	90,053,535 (GRCm39)	missense	probably benign	0.00
R6649:Adamts7	UTSW	9	90,073,990 (GRCm39)	missense	probably damaging	1.00
R6658:Adamts7	UTSW	9	90,077,353 (GRCm39)	missense	probably damaging	0.99
R6874:Adamts7	UTSW	9	90,070,784 (GRCm39)	missense	probably damaging	1.00
R6947:Adamts7	UTSW	9	90,073,857 (GRCm39)	splice site	probably null
R7110:Adamts7	UTSW	9	90,076,017 (GRCm39)	missense	possibly damaging	0.92
R7224:Adamts7	UTSW	9	90,067,868 (GRCm39)	missense	probably damaging	1.00
R7239:Adamts7	UTSW	9	90,068,610 (GRCm39)	splice site	probably null
R7519:Adamts7	UTSW	9	90,079,132 (GRCm39)	missense	probably benign	0.22
R7608:Adamts7	UTSW	9	90,055,826 (GRCm39)	missense	possibly damaging	0.68
R7635:Adamts7	UTSW	9	90,077,298 (GRCm39)	missense	probably damaging	1.00
R7699:Adamts7	UTSW	9	90,070,792 (GRCm39)	missense	probably damaging	1.00
R8519:Adamts7	UTSW	9	90,075,610 (GRCm39)	nonsense	probably null
R8680:Adamts7	UTSW	9	90,077,321 (GRCm39)	missense	probably damaging	1.00
R8743:Adamts7	UTSW	9	90,077,296 (GRCm39)	missense	probably damaging	0.99
R8784:Adamts7	UTSW	9	90,075,918 (GRCm39)	missense	probably null	0.00
R8794:Adamts7	UTSW	9	90,076,239 (GRCm39)	nonsense	probably null
R8851:Adamts7	UTSW	9	90,075,163 (GRCm39)	missense	probably benign	0.00
R9025:Adamts7	UTSW	9	90,067,848 (GRCm39)	nonsense	probably null
R9038:Adamts7	UTSW	9	90,056,692 (GRCm39)	missense
R9101:Adamts7	UTSW	9	90,071,794 (GRCm39)	critical splice donor site	probably null
R9256:Adamts7	UTSW	9	90,060,218 (GRCm39)	missense	probably damaging	1.00
R9261:Adamts7	UTSW	9	90,075,397 (GRCm39)	missense	probably benign	0.01
R9385:Adamts7	UTSW	9	90,077,258 (GRCm39)	nonsense	probably null
R9614:Adamts7	UTSW	9	90,077,251 (GRCm39)	missense	probably damaging	1.00
X0028:Adamts7	UTSW	9	90,060,270 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- ACATCATGTTGCATTCATGTGC -3'
(R):5'- CCAAGGGTTGCTGCCAATTC -3'

Sequencing Primer
(F):5'- GCATTCATGTGCATAGAATGTCTC -3'
(R):5'- GTCTCAGCGACTCCTCACAGAG -3'

Posted On

2016-06-06