Incidental Mutation 'R5064:Mllt6'
ID 388268
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms Af17
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5064 (G1)
Quality Score 201
Status Validated
Chromosome 11
Chromosomal Location 97663414-97685463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 97673949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 527 (A527E)
Ref Sequence ENSEMBL: ENSMUSP00000103212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
AlphaFold B1AR10
Predicted Effect possibly damaging
Transcript: ENSMUST00000044730
AA Change: A497E

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: A497E

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107586
AA Change: A527E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: A527E

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184494
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Ascl2 T C 7: 142,968,259 N151D possibly damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nasp A G 4: 116,611,970 probably null Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Plppr1 A T 4: 49,319,974 H200L probably benign Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn1r55 A T 7: 5,146,929 M165K probably benign Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Vta1 G T 10: 14,705,478 probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97676928 missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97672484 missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97674777 missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97670332 missense probably benign 0.01
IGL03161:Mllt6 APN 11 97667151 missense probably benign 0.03
R0284:Mllt6 UTSW 11 97678605 missense probably benign 0.02
R0718:Mllt6 UTSW 11 97676359 splice site probably benign
R0783:Mllt6 UTSW 11 97665745 missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97664998 missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97664946 splice site probably benign
R1445:Mllt6 UTSW 11 97672451 splice site probably benign
R1523:Mllt6 UTSW 11 97665023 missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97672569 missense probably benign
R1952:Mllt6 UTSW 11 97677222 missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97680776 missense probably damaging 0.98
R4866:Mllt6 UTSW 11 97674459 missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97678407 missense probably benign
R5039:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5076:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97673505 missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97672574 missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97680743 nonsense probably null
R6180:Mllt6 UTSW 11 97678536 missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97673948 missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97676934 missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97674447 missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97680602 missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97673811 missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97673568 missense probably benign 0.23
R7387:Mllt6 UTSW 11 97674600 missense probably benign 0.04
R7484:Mllt6 UTSW 11 97672616 missense probably benign 0.18
R7685:Mllt6 UTSW 11 97676964 missense probably damaging 0.99
R7853:Mllt6 UTSW 11 97670316 missense probably benign
R7862:Mllt6 UTSW 11 97665805 missense probably benign 0.03
R8004:Mllt6 UTSW 11 97676140 missense possibly damaging 0.91
R8498:Mllt6 UTSW 11 97676862 missense possibly damaging 0.86
R9044:Mllt6 UTSW 11 97663659 missense probably damaging 1.00
R9297:Mllt6 UTSW 11 97672488 missense probably damaging 0.96
R9457:Mllt6 UTSW 11 97665760 missense probably benign 0.12
R9557:Mllt6 UTSW 11 97673484 missense probably benign 0.04
Z1177:Mllt6 UTSW 11 97676425 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATAAGTCTCCCCATATTACCGGG -3'
(R):5'- ACACGACTGGCTGTACATGG -3'

Sequencing Primer
(F):5'- CACTGAGTGCCACCCTTG -3'
(R):5'- CATGGAGCCATTCTTTAGCGACAG -3'
Posted On 2016-06-06