Mutagenetix > Incidental Mutations

Incidental Mutation 'R5064:Asxl3'

388275

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

042654-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.464) question?

Stock #

R5064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 22516019 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 355 (S355I)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

Predicted Effect

probably benign
Transcript: ENSMUST00000097655
AA Change: S355I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: S355I

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120223
AA Change: S355I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: S355I

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Meta Mutation Damage Score

0.0624

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.1%

Validation Efficiency

100% (44/44)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	A	G	7: 29,535,655		noncoding transcript	Het
Abca12	A	G	1: 71,300,960	V1082A	probably damaging	Het
Adamts7	T	A	9: 90,195,830	Y1496N	probably damaging	Het
Ascl2	T	C	7: 142,968,259	N151D	possibly damaging	Het
Cttnbp2	T	C	6: 18,448,279	Q127R	probably damaging	Het
Efhc1	T	A	1: 20,974,963	I401N	possibly damaging	Het
Eml6	C	T	11: 29,749,300	V1818I	probably benign	Het
Fam129a	A	G	1: 151,689,659	I247V	probably benign	Het
Grin1	G	T	2: 25,303,831		probably benign	Het
Ints2	C	T	11: 86,249,274	R244H	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mllt6	C	A	11: 97,673,949	A527E	probably damaging	Het
Msh5	G	T	17: 35,043,783		probably benign	Het
Mypn	T	A	10: 63,123,371	D1057V	possibly damaging	Het
Nasp	A	G	4: 116,611,970		probably null	Het
Nat8l	T	C	5: 33,996,869	V9A	probably damaging	Het
Nr1h2	G	A	7: 44,551,649	A219V	possibly damaging	Het
Nup155	C	A	15: 8,135,870	H663Q	probably damaging	Het
Pikfyve	A	G	1: 65,253,407	Y1339C	probably damaging	Het
Plppr1	A	T	4: 49,319,974	H200L	probably benign	Het
Por	T	C	5: 135,733,795	V421A	probably benign	Het
Pxylp1	T	G	9: 96,854,800		probably benign	Het
Serpina3a	G	A	12: 104,116,189	V74I	probably benign	Het
Sfxn1	T	C	13: 54,085,569	I37T	probably benign	Het
Thsd7a	G	T	6: 12,330,952	T1397N	possibly damaging	Het
Tnrc6a	T	C	7: 123,186,723		probably null	Het
Vmn1r55	A	T	7: 5,146,929	M165K	probably benign	Het
Vmn2r58	A	T	7: 41,837,110	M787K	probably damaging	Het
Vta1	G	T	10: 14,705,478		probably benign	Het
Zfp236	A	G	18: 82,691,576		probably null	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGTAAGAGATCCAATCTGAGCC -3'
(R):5'- AAGATGTTCATCTTGGCATTCGTAG -3'

Sequencing Primer
(F):5'- GAGATCCAATCTGAGCCTTTTATTTC -3'
(R):5'- ATCTTGGCATTCGTAGATACTCG -3'

Posted On

2016-06-06