Incidental Mutation 'R5065:Sema3c'
ID 388284
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission 042655-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5065 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17932615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 706 (N706S)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect possibly damaging
Transcript: ENSMUST00000030568
AA Change: N706S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: N706S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115271
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,779,893 (GRCm39) N120Y probably damaging Het
A930011G23Rik G A 5: 99,382,432 (GRCm39) T272M probably benign Het
Aldh9a1 A G 1: 167,180,128 (GRCm39) E74G probably damaging Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Bcl2l10 A T 9: 75,255,261 (GRCm39) E26V possibly damaging Het
Cspg4b T A 13: 113,457,453 (GRCm39) H1166Q probably benign Het
Dennd2a C A 6: 39,472,110 (GRCm39) probably null Het
Dock3 A G 9: 106,832,883 (GRCm39) F129L probably damaging Het
Gm4847 A T 1: 166,462,359 (GRCm39) I377N probably damaging Het
Gm8674 T C 13: 50,056,613 (GRCm39) noncoding transcript Het
Hhipl2 A T 1: 183,207,580 (GRCm39) H433L probably benign Het
Hsfy2 G A 1: 56,675,626 (GRCm39) Q304* probably null Het
Ighg2c T C 12: 113,251,708 (GRCm39) I140V unknown Het
Kmt2a T C 9: 44,753,997 (GRCm39) probably benign Het
Map3k5 A G 10: 19,958,213 (GRCm39) E671G probably damaging Het
Map6 A G 7: 98,985,917 (GRCm39) D607G probably benign Het
Mroh4 C T 15: 74,500,119 (GRCm39) probably null Het
Or10g6 A G 9: 39,934,546 (GRCm39) I286V probably benign Het
Pcsk6 A G 7: 65,560,047 (GRCm39) D124G possibly damaging Het
Pkhd1l1 T A 15: 44,445,689 (GRCm39) N3790K possibly damaging Het
Polr3b C A 10: 84,468,402 (GRCm39) N129K probably benign Het
Ptpn23 A T 9: 110,227,256 (GRCm39) L31Q possibly damaging Het
Sipa1l2 T C 8: 126,218,324 (GRCm39) I338V probably benign Het
Slc39a7 A G 17: 34,250,033 (GRCm39) probably benign Het
Snd1 C A 6: 28,888,239 (GRCm39) N891K probably damaging Het
Sntg1 A G 1: 8,433,663 (GRCm39) probably benign Het
Stxbp5 A T 10: 9,646,295 (GRCm39) L780Q probably damaging Het
Tacr1 G A 6: 82,531,859 (GRCm39) V252M possibly damaging Het
Tdrp T C 8: 14,003,791 (GRCm39) E182G probably damaging Het
Vmn1r58 A G 7: 5,413,834 (GRCm39) I132T probably benign Het
Wap A T 11: 6,586,840 (GRCm39) N86K probably damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R0964:Sema3c UTSW 5 17,926,907 (GRCm39) missense probably damaging 1.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4546:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17,922,068 (GRCm39) critical splice donor site probably null
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5811:Sema3c UTSW 5 17,880,188 (GRCm39) splice site probably null
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9477:Sema3c UTSW 5 17,921,981 (GRCm39) missense
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCAAGATTCTGACCAAGGAC -3'
(R):5'- GCATTTGTTCCTGGAAGCAAAAC -3'

Sequencing Primer
(F):5'- TTGCCACTGAGAACAGCTTC -3'
(R):5'- GTTGATGAGAGCCTTCAG -3'
Posted On 2016-06-06