Incidental Mutation 'R5065:A930011G23Rik'
ID388285
Institutional Source Beutler Lab
Gene Symbol A930011G23Rik
Ensembl Gene ENSMUSG00000089809
Gene NameRIKEN cDNA A930011G23 gene
Synonyms
MMRRC Submission 042655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5065 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location99297244-99729065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99234573 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 272 (T272M)
Ref Sequence ENSEMBL: ENSMUSP00000147997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031276] [ENSMUST00000166484] [ENSMUST00000168092] [ENSMUST00000209346]
Predicted Effect probably benign
Transcript: ENSMUST00000031276
AA Change: T186M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031276
Gene: ENSMUSG00000089809
AA Change: T186M

DomainStartEndE-ValueType
RasGEFN 33 157 5.22e-4 SMART
RasGEF 201 454 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166484
AA Change: T144M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128947
Gene: ENSMUSG00000089809
AA Change: T144M

DomainStartEndE-ValueType
Blast:RasGEFN 33 123 6e-50 BLAST
RasGEF 159 412 3.26e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166632
Predicted Effect probably benign
Transcript: ENSMUST00000168092
AA Change: T185M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129652
Gene: ENSMUSG00000089809
AA Change: T185M

DomainStartEndE-ValueType
RasGEFN 33 157 2.8e-4 SMART
RasGEF 200 453 3.26e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209346
AA Change: T272M

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,852,155 N120Y probably damaging Het
Aldh9a1 A G 1: 167,352,559 E74G probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
BC067074 T A 13: 113,320,919 H1166Q probably benign Het
Bcl2l10 A T 9: 75,347,979 E26V possibly damaging Het
Dennd2a C A 6: 39,495,176 probably null Het
Dock3 A G 9: 106,955,684 F129L probably damaging Het
Gm4847 A T 1: 166,634,790 I377N probably damaging Het
Gm8674 T C 13: 49,902,577 noncoding transcript Het
Hhipl2 A T 1: 183,426,672 H433L probably benign Het
Hsfy2 G A 1: 56,636,467 Q304* probably null Het
Ighg2c T C 12: 113,288,088 I140V unknown Het
Kmt2a T C 9: 44,842,700 probably benign Het
Map3k5 A G 10: 20,082,467 E671G probably damaging Het
Map6 A G 7: 99,336,710 D607G probably benign Het
Mroh4 C T 15: 74,628,270 probably null Het
Olfr981 A G 9: 40,023,250 I286V probably benign Het
Pcsk6 A G 7: 65,910,299 D124G possibly damaging Het
Pkhd1l1 T A 15: 44,582,293 N3790K possibly damaging Het
Polr3b C A 10: 84,632,538 N129K probably benign Het
Ptpn23 A T 9: 110,398,188 L31Q possibly damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Sipa1l2 T C 8: 125,491,585 I338V probably benign Het
Slc39a7 A G 17: 34,031,059 probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Sntg1 A G 1: 8,363,439 probably benign Het
Stxbp5 A T 10: 9,770,551 L780Q probably damaging Het
Tacr1 G A 6: 82,554,878 V252M possibly damaging Het
Tdrp T C 8: 13,953,791 E182G probably damaging Het
Vmn1r58 A G 7: 5,410,835 I132T probably benign Het
Wap A T 11: 6,636,840 N86K probably damaging Het
Other mutations in A930011G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:A930011G23Rik APN 5 99243243 unclassified probably null
IGL00536:A930011G23Rik APN 5 99222383 missense probably damaging 1.00
IGL00848:A930011G23Rik APN 5 99222378 missense probably damaging 1.00
IGL01400:A930011G23Rik APN 5 99243101 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02427:A930011G23Rik APN 5 99233970 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02473:A930011G23Rik APN 5 99222995 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02609:A930011G23Rik APN 5 99233995 splice site probably benign
IGL02735:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02735:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02975:A930011G23Rik APN 5 99233925 missense possibly damaging 0.81
IGL03129:A930011G23Rik APN 5 99229379 missense probably damaging 0.98
IGL03139:A930011G23Rik APN 5 99243208 missense probably benign 0.00
IGL03239:A930011G23Rik APN 5 99233976 missense probably damaging 1.00
IGL03295:A930011G23Rik APN 5 99243056 splice site probably benign
R0011:A930011G23Rik UTSW 5 99232354 missense probably damaging 1.00
R0738:A930011G23Rik UTSW 5 99240953 missense probably benign 0.08
R0840:A930011G23Rik UTSW 5 99234688 missense probably benign 0.00
R1779:A930011G23Rik UTSW 5 99223038 splice site probably benign
R1799:A930011G23Rik UTSW 5 99234576 missense probably benign 0.01
R1992:A930011G23Rik UTSW 5 99233925 missense possibly damaging 0.81
R2054:A930011G23Rik UTSW 5 99228055 missense probably benign 0.01
R2157:A930011G23Rik UTSW 5 99232097 missense probably damaging 0.99
R2184:A930011G23Rik UTSW 5 99232369 missense possibly damaging 0.69
R4565:A930011G23Rik UTSW 5 99227947 intron probably benign
R4930:A930011G23Rik UTSW 5 99222404 missense possibly damaging 0.81
R5739:A930011G23Rik UTSW 5 99221430 missense probably damaging 1.00
R5806:A930011G23Rik UTSW 5 99240872 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATCACGCTCTGGCTGCTTTG -3'
(R):5'- CCTCACAGTGCTGGAGAAGAAG -3'

Sequencing Primer
(F):5'- TCTCCCGAGATTTACTATCAGCCAAC -3'
(R):5'- GCAGGGCAAGAATACCATCCTC -3'
Posted On2016-06-06