Mutagenetix > Incidental Mutation

Incidental Mutation 'R5065:Map6'

388291

Institutional Source

Beutler Lab

Gene Symbol

Map6

Ensembl Gene

ENSMUSG00000055407

Gene Name

microtubule-associated protein 6

Synonyms

F-STOP, Mtap6, 2810411E12Rik, STOP

MMRRC Submission

042655-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R5065 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

99267447-99337137 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99336710 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 607 (D607G)

Ref Sequence

ENSEMBL: ENSMUSP00000146954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]

AlphaFold

Q7TSJ2

Predicted Effect

probably benign
Transcript: ENSMUST00000068973
AA Change: D810G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: D810G

Domain	Start	End	E-Value	Type
low complexity region	42	57	N/A	INTRINSIC
low complexity region	93	117	N/A	INTRINSIC
internal_repeat_1	191	306	6.21e-27	PROSPERO
internal_repeat_1	302	398	6.21e-27	PROSPERO
low complexity region	501	525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107100

SMART Domains

Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
internal_repeat_1	28	103	5.9e-29	PROSPERO
internal_repeat_1	120	195	5.9e-29	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000122101

SMART Domains

Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

Domain	Start	End	E-Value	Type
Pfam:STOP	1	184	1.2e-18	PFAM
internal_repeat_1	191	306	1.99e-35	PROSPERO
internal_repeat_1	302	398	1.99e-35	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000207883
AA Change: D810G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000208605

Predicted Effect

probably benign
Transcript: ENSMUST00000208924
AA Change: D607G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,852,155	N120Y	probably damaging	Het
A930011G23Rik	G	A	5: 99,234,573	T272M	probably benign	Het
Aldh9a1	A	G	1: 167,352,559	E74G	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
BC067074	T	A	13: 113,320,919	H1166Q	probably benign	Het
Bcl2l10	A	T	9: 75,347,979	E26V	possibly damaging	Het
Dennd2a	C	A	6: 39,495,176		probably null	Het
Dock3	A	G	9: 106,955,684	F129L	probably damaging	Het
Gm4847	A	T	1: 166,634,790	I377N	probably damaging	Het
Gm8674	T	C	13: 49,902,577		noncoding transcript	Het
Hhipl2	A	T	1: 183,426,672	H433L	probably benign	Het
Hsfy2	G	A	1: 56,636,467	Q304*	probably null	Het
Ighg2c	T	C	12: 113,288,088	I140V	unknown	Het
Kmt2a	T	C	9: 44,842,700		probably benign	Het
Map3k5	A	G	10: 20,082,467	E671G	probably damaging	Het
Mroh4	C	T	15: 74,628,270		probably null	Het
Olfr981	A	G	9: 40,023,250	I286V	probably benign	Het
Pcsk6	A	G	7: 65,910,299	D124G	possibly damaging	Het
Pkhd1l1	T	A	15: 44,582,293	N3790K	possibly damaging	Het
Polr3b	C	A	10: 84,632,538	N129K	probably benign	Het
Ptpn23	A	T	9: 110,398,188	L31Q	possibly damaging	Het
Sema3c	A	G	5: 17,727,617	N706S	possibly damaging	Het
Sipa1l2	T	C	8: 125,491,585	I338V	probably benign	Het
Slc39a7	A	G	17: 34,031,059		probably benign	Het
Snd1	C	A	6: 28,888,240	N891K	probably damaging	Het
Sntg1	A	G	1: 8,363,439		probably benign	Het
Stxbp5	A	T	10: 9,770,551	L780Q	probably damaging	Het
Tacr1	G	A	6: 82,554,878	V252M	possibly damaging	Het
Tdrp	T	C	8: 13,953,791	E182G	probably damaging	Het
Vmn1r58	A	G	7: 5,410,835	I132T	probably benign	Het
Wap	A	T	11: 6,636,840	N86K	probably damaging	Het

Other mutations in Map6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0035:Map6	UTSW	7	99317608	missense	probably damaging	1.00
R0035:Map6	UTSW	7	99317608	missense	probably damaging	1.00
R0118:Map6	UTSW	7	99317617	missense	possibly damaging	0.53
R0125:Map6	UTSW	7	99335980	splice site	probably null
R0244:Map6	UTSW	7	99336836	missense	probably benign	0.00
R0973:Map6	UTSW	7	99336743	missense	possibly damaging	0.78
R0973:Map6	UTSW	7	99336743	missense	possibly damaging	0.78
R0974:Map6	UTSW	7	99336743	missense	possibly damaging	0.78
R1455:Map6	UTSW	7	99268214	missense	probably damaging	1.00
R1678:Map6	UTSW	7	99268098	missense	probably damaging	1.00
R1696:Map6	UTSW	7	99317457	splice site	probably null
R1866:Map6	UTSW	7	99315876	missense	probably damaging	1.00
R2061:Map6	UTSW	7	99317472	missense	probably damaging	1.00
R3236:Map6	UTSW	7	99336824	missense	probably damaging	1.00
R3625:Map6	UTSW	7	99269195	missense	possibly damaging	0.60
R4044:Map6	UTSW	7	99268049	missense	probably damaging	1.00
R4570:Map6	UTSW	7	99336556	missense	possibly damaging	0.49
R5056:Map6	UTSW	7	99336652	missense	probably benign	0.05
R5656:Map6	UTSW	7	99336298	missense	probably damaging	1.00
R6101:Map6	UTSW	7	99268107	missense	probably damaging	1.00
R6105:Map6	UTSW	7	99268107	missense	probably damaging	1.00
R6302:Map6	UTSW	7	99336107	missense	probably damaging	0.99
R6450:Map6	UTSW	7	99268038	missense	probably damaging	1.00
R6915:Map6	UTSW	7	99268247	missense	probably damaging	1.00
R7205:Map6	UTSW	7	99269050	missense	probably benign	0.00
R7223:Map6	UTSW	7	99268025	missense	probably damaging	1.00
R7293:Map6	UTSW	7	99336533	missense	possibly damaging	0.49
R7481:Map6	UTSW	7	99269138	missense	possibly damaging	0.57
R7489:Map6	UTSW	7	99268061	missense	probably damaging	1.00
R7691:Map6	UTSW	7	99336292	missense	possibly damaging	0.95
R7693:Map6	UTSW	7	99336292	missense	possibly damaging	0.95
R7695:Map6	UTSW	7	99336292	missense	possibly damaging	0.95
R8341:Map6	UTSW	7	99268440	missense	possibly damaging	0.75
R8865:Map6	UTSW	7	99268985	missense	probably benign	0.37
R8953:Map6	UTSW	7	99315871	missense	probably damaging	1.00
R9108:Map6	UTSW	7	99336896	missense	probably damaging	1.00
R9173:Map6	UTSW	7	99268728	missense	probably damaging	1.00
R9613:Map6	UTSW	7	99269177	missense	possibly damaging	0.90
R9654:Map6	UTSW	7	99336959	missense	probably damaging	1.00
Z1176:Map6	UTSW	7	99317660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCATGGCCTCTTTGAAGAACG -3'
(R):5'- TGGGACCTTGAGTCTTCAGAG -3'

Sequencing Primer
(F):5'- TTGAAGAACGAAGCTCCTATGGTCC -3'
(R):5'- ACCTTGAGTCTTCAGAGGGTCAG -3'

Posted On

2016-06-06