Incidental Mutation 'R5065:Map6'
ID 388291
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 042655-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R5065 (G1)
Quality Score 158
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98985917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 607 (D607G)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably benign
Transcript: ENSMUST00000068973
AA Change: D810G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: D810G

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000207883
AA Change: D810G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
AA Change: D607G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,779,893 (GRCm39) N120Y probably damaging Het
A930011G23Rik G A 5: 99,382,432 (GRCm39) T272M probably benign Het
Aldh9a1 A G 1: 167,180,128 (GRCm39) E74G probably damaging Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Bcl2l10 A T 9: 75,255,261 (GRCm39) E26V possibly damaging Het
Cspg4b T A 13: 113,457,453 (GRCm39) H1166Q probably benign Het
Dennd2a C A 6: 39,472,110 (GRCm39) probably null Het
Dock3 A G 9: 106,832,883 (GRCm39) F129L probably damaging Het
Gm4847 A T 1: 166,462,359 (GRCm39) I377N probably damaging Het
Gm8674 T C 13: 50,056,613 (GRCm39) noncoding transcript Het
Hhipl2 A T 1: 183,207,580 (GRCm39) H433L probably benign Het
Hsfy2 G A 1: 56,675,626 (GRCm39) Q304* probably null Het
Ighg2c T C 12: 113,251,708 (GRCm39) I140V unknown Het
Kmt2a T C 9: 44,753,997 (GRCm39) probably benign Het
Map3k5 A G 10: 19,958,213 (GRCm39) E671G probably damaging Het
Mroh4 C T 15: 74,500,119 (GRCm39) probably null Het
Or10g6 A G 9: 39,934,546 (GRCm39) I286V probably benign Het
Pcsk6 A G 7: 65,560,047 (GRCm39) D124G possibly damaging Het
Pkhd1l1 T A 15: 44,445,689 (GRCm39) N3790K possibly damaging Het
Polr3b C A 10: 84,468,402 (GRCm39) N129K probably benign Het
Ptpn23 A T 9: 110,227,256 (GRCm39) L31Q possibly damaging Het
Sema3c A G 5: 17,932,615 (GRCm39) N706S possibly damaging Het
Sipa1l2 T C 8: 126,218,324 (GRCm39) I338V probably benign Het
Slc39a7 A G 17: 34,250,033 (GRCm39) probably benign Het
Snd1 C A 6: 28,888,239 (GRCm39) N891K probably damaging Het
Sntg1 A G 1: 8,433,663 (GRCm39) probably benign Het
Stxbp5 A T 10: 9,646,295 (GRCm39) L780Q probably damaging Het
Tacr1 G A 6: 82,531,859 (GRCm39) V252M possibly damaging Het
Tdrp T C 8: 14,003,791 (GRCm39) E182G probably damaging Het
Vmn1r58 A G 7: 5,413,834 (GRCm39) I132T probably benign Het
Wap A T 11: 6,586,840 (GRCm39) N86K probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGGCCTCTTTGAAGAACG -3'
(R):5'- TGGGACCTTGAGTCTTCAGAG -3'

Sequencing Primer
(F):5'- TTGAAGAACGAAGCTCCTATGGTCC -3'
(R):5'- ACCTTGAGTCTTCAGAGGGTCAG -3'
Posted On 2016-06-06