Incidental Mutation 'R5065:Polr3b'
ID 388300
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission 042655-MU
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5065 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 84632538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 129 (N129K)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
AA Change: N129K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: N129K

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213263
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,852,155 N120Y probably damaging Het
A930011G23Rik G A 5: 99,234,573 T272M probably benign Het
Aldh9a1 A G 1: 167,352,559 E74G probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
BC067074 T A 13: 113,320,919 H1166Q probably benign Het
Bcl2l10 A T 9: 75,347,979 E26V possibly damaging Het
Dennd2a C A 6: 39,495,176 probably null Het
Dock3 A G 9: 106,955,684 F129L probably damaging Het
Gm4847 A T 1: 166,634,790 I377N probably damaging Het
Gm8674 T C 13: 49,902,577 noncoding transcript Het
Hhipl2 A T 1: 183,426,672 H433L probably benign Het
Hsfy2 G A 1: 56,636,467 Q304* probably null Het
Ighg2c T C 12: 113,288,088 I140V unknown Het
Kmt2a T C 9: 44,842,700 probably benign Het
Map3k5 A G 10: 20,082,467 E671G probably damaging Het
Map6 A G 7: 99,336,710 D607G probably benign Het
Mroh4 C T 15: 74,628,270 probably null Het
Olfr981 A G 9: 40,023,250 I286V probably benign Het
Pcsk6 A G 7: 65,910,299 D124G possibly damaging Het
Pkhd1l1 T A 15: 44,582,293 N3790K possibly damaging Het
Ptpn23 A T 9: 110,398,188 L31Q possibly damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Sipa1l2 T C 8: 125,491,585 I338V probably benign Het
Slc39a7 A G 17: 34,031,059 probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Sntg1 A G 1: 8,363,439 probably benign Het
Stxbp5 A T 10: 9,770,551 L780Q probably damaging Het
Tacr1 G A 6: 82,554,878 V252M possibly damaging Het
Tdrp T C 8: 13,953,791 E182G probably damaging Het
Vmn1r58 A G 7: 5,410,835 I132T probably benign Het
Wap A T 11: 6,636,840 N86K probably damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTTCAGGCTGCTGTGC -3'
(R):5'- AGCATTTCCTCAGCTTTAGAGACTG -3'

Sequencing Primer
(F):5'- CAGGCTGCTGTGCACTGTATTC -3'
(R):5'- GTAAACCACAGCTCTGTCTGG -3'
Posted On 2016-06-06