Incidental Mutation 'R5065:Gm8674'
ID388304
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Namepredicted gene 8674
Synonyms
MMRRC Submission 042655-MU
Accession Numbers

Genbank: XM_990959; MGI: 3645762

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5065 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49899119-49904597 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 49902577 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,852,155 N120Y probably damaging Het
A930011G23Rik G A 5: 99,234,573 T272M probably benign Het
Aldh9a1 A G 1: 167,352,559 E74G probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
BC067074 T A 13: 113,320,919 H1166Q probably benign Het
Bcl2l10 A T 9: 75,347,979 E26V possibly damaging Het
Dennd2a C A 6: 39,495,176 probably null Het
Dock3 A G 9: 106,955,684 F129L probably damaging Het
Gm4847 A T 1: 166,634,790 I377N probably damaging Het
Hhipl2 A T 1: 183,426,672 H433L probably benign Het
Hsfy2 G A 1: 56,636,467 Q304* probably null Het
Ighg2c T C 12: 113,288,088 I140V unknown Het
Kmt2a T C 9: 44,842,700 probably benign Het
Map3k5 A G 10: 20,082,467 E671G probably damaging Het
Map6 A G 7: 99,336,710 D607G probably benign Het
Mroh4 C T 15: 74,628,270 probably null Het
Olfr981 A G 9: 40,023,250 I286V probably benign Het
Pcsk6 A G 7: 65,910,299 D124G possibly damaging Het
Pkhd1l1 T A 15: 44,582,293 N3790K possibly damaging Het
Polr3b C A 10: 84,632,538 N129K probably benign Het
Ptpn23 A T 9: 110,398,188 L31Q possibly damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Sipa1l2 T C 8: 125,491,585 I338V probably benign Het
Slc39a7 A G 17: 34,031,059 probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Sntg1 A G 1: 8,363,439 probably benign Het
Stxbp5 A T 10: 9,770,551 L780Q probably damaging Het
Tacr1 G A 6: 82,554,878 V252M possibly damaging Het
Tdrp T C 8: 13,953,791 E182G probably damaging Het
Vmn1r58 A G 7: 5,410,835 I132T probably benign Het
Wap A T 11: 6,636,840 N86K probably damaging Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 49901939 exon noncoding transcript
R0357:Gm8674 UTSW 13 49902113 exon noncoding transcript
R0627:Gm8674 UTSW 13 49899715 exon noncoding transcript
R0833:Gm8674 UTSW 13 49904575 exon noncoding transcript
R1300:Gm8674 UTSW 13 49901722 exon noncoding transcript
R1452:Gm8674 UTSW 13 49900517 exon noncoding transcript
R1542:Gm8674 UTSW 13 49900003 exon noncoding transcript
R1613:Gm8674 UTSW 13 49902438 intron noncoding transcript
R1643:Gm8674 UTSW 13 49901358 exon noncoding transcript
R1732:Gm8674 UTSW 13 49901926 exon noncoding transcript
R1824:Gm8674 UTSW 13 49900808 exon noncoding transcript
R1840:Gm8674 UTSW 13 49901765 exon noncoding transcript
R1915:Gm8674 UTSW 13 49900853 exon noncoding transcript
R1934:Gm8674 UTSW 13 49901435 exon noncoding transcript
R2040:Gm8674 UTSW 13 49901669 exon noncoding transcript
R2214:Gm8674 UTSW 13 49901360 exon noncoding transcript
R2421:Gm8674 UTSW 13 49900663 exon noncoding transcript
R3423:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3425:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3886:Gm8674 UTSW 13 49902163 splice site noncoding transcript
R4083:Gm8674 UTSW 13 49901011 exon noncoding transcript
R4343:Gm8674 UTSW 13 49899706 exon noncoding transcript
R4570:Gm8674 UTSW 13 49902534 intron noncoding transcript
R4936:Gm8674 UTSW 13 49900755 exon noncoding transcript
R4967:Gm8674 UTSW 13 49901998 exon noncoding transcript
R5067:Gm8674 UTSW 13 49899834 exon noncoding transcript
R5120:Gm8674 UTSW 13 49901948 exon noncoding transcript
R5208:Gm8674 UTSW 13 49901921 exon noncoding transcript
R5268:Gm8674 UTSW 13 49901354 exon noncoding transcript
R5471:Gm8674 UTSW 13 49900813 exon noncoding transcript
R5773:Gm8674 UTSW 13 49901876 exon noncoding transcript
R5809:Gm8674 UTSW 13 49901888 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49900794 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49901248 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCCTCCATGTCACATGTTCAG -3'
(R):5'- AGCTTCAATTCTCACAGCTGC -3'

Sequencing Primer
(F):5'- CCATGTCACATGTTCAGAAGTC -3'
(R):5'- TCAGATAAATGGTGCTGTGTCC -3'
Posted On2016-06-06