Incidental Mutation 'R5066:Mndal'
ID388311
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Namemyeloid nuclear differentiation antigen like
SynonymsGm2785
MMRRC Submission 042656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173849126-173942491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 173875663 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 59 (A59S)
Ref Sequence ENSEMBL: ENSMUSP00000140191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071] [ENSMUST00000190651]
Predicted Effect unknown
Transcript: ENSMUST00000111210
AA Change: A59S
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: A59S

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186442
AA Change: A59S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: A59S

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187636
Predicted Effect unknown
Transcript: ENSMUST00000188804
AA Change: A59S
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: A59S

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189501
Predicted Effect probably benign
Transcript: ENSMUST00000190071
SMART Domains Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
internal_repeat_1 21 35 3.67e-8 PROSPERO
low complexity region 39 69 N/A INTRINSIC
internal_repeat_1 77 91 3.67e-8 PROSPERO
low complexity region 94 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190651
AA Change: A59S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140191
Gene: ENSMUSG00000090272
AA Change: A59S

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
low complexity region 170 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191500
Meta Mutation Damage Score 0.7001 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atp1a1 C T 3: 101,582,104 G731R probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Bcl2l13 T A 6: 120,887,021 V312E possibly damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Flt4 A G 11: 49,634,163 N612S possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Nfx1 A G 4: 40,991,868 I519V probably benign Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Sybu A G 15: 44,677,644 C341R probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173857456 missense possibly damaging 0.68
IGL02309:Mndal APN 1 173874455 missense probably damaging 0.98
IGL02559:Mndal APN 1 173872920 missense probably benign 0.06
IGL02637:Mndal APN 1 173857437 missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173880218 unclassified probably benign
R0076:Mndal UTSW 1 173874447 nonsense probably null
R0123:Mndal UTSW 1 173857513 splice site probably benign
R0134:Mndal UTSW 1 173857513 splice site probably benign
R0225:Mndal UTSW 1 173857513 splice site probably benign
R0976:Mndal UTSW 1 173862845 missense possibly damaging 0.70
R1081:Mndal UTSW 1 173860222 missense probably benign 0.01
R1497:Mndal UTSW 1 173872875 missense probably benign 0.04
R1522:Mndal UTSW 1 173871466 missense possibly damaging 0.68
R1630:Mndal UTSW 1 173874392 missense possibly damaging 0.52
R1874:Mndal UTSW 1 173860367 unclassified probably benign
R4183:Mndal UTSW 1 173875771 missense possibly damaging 0.95
R4544:Mndal UTSW 1 173875664 nonsense probably null
R4545:Mndal UTSW 1 173875664 nonsense probably null
R4907:Mndal UTSW 1 173862690 missense probably damaging 0.99
R5853:Mndal UTSW 1 173862504 missense probably damaging 0.98
R6208:Mndal UTSW 1 173857422 missense possibly damaging 0.84
R6395:Mndal UTSW 1 173871433 missense possibly damaging 0.73
R6923:Mndal UTSW 1 173884698 splice site probably null
R6933:Mndal UTSW 1 173875683 missense probably damaging 1.00
R7030:Mndal UTSW 1 173875594 missense probably damaging 1.00
R7327:Mndal UTSW 1 173875619 missense unknown
R7648:Mndal UTSW 1 173857395 missense probably benign 0.01
R8130:Mndal UTSW 1 173871545 nonsense probably null
R8514:Mndal UTSW 1 173860192 missense possibly damaging 0.84
Z1177:Mndal UTSW 1 173874404 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGGCATATCAGCTGTGATC -3'
(R):5'- TCACTCACATGAGAATATCCTGTCTTG -3'

Sequencing Primer
(F):5'- TCACACAGGGAGTTAGCAAGTTTG -3'
(R):5'- CTATAATTTGAGAGACGATGGCTG -3'
Posted On2016-06-06