Incidental Mutation 'R5066:Atp1a1'
ID388313
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene NameATPase, Na+/K+ transporting, alpha 1 polypeptide
SynonymsAtpa-1
MMRRC Submission 042656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101576219-101604684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101582104 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 731 (G731R)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
Predicted Effect probably damaging
Transcript: ENSMUST00000036493
AA Change: G731R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: G731R

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197360
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Bcl2l13 T A 6: 120,887,021 V312E possibly damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Flt4 A G 11: 49,634,163 N612S possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mndal C A 1: 173,875,663 A59S probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Nfx1 A G 4: 40,991,868 I519V probably benign Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Sybu A G 15: 44,677,644 C341R probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101584854 missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101579624 missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101586904 missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101582762 missense probably benign
R8461:Atp1a1 UTSW 3 101589089 missense probably benign 0.01
R8772:Atp1a1 UTSW 3 101579808 missense probably benign
R8782:Atp1a1 UTSW 3 101594217 missense possibly damaging 0.63
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGACCTGAAGACAAGCTCAC -3'
(R):5'- TGGGGTCCATGTCTACTTAGCC -3'

Sequencing Primer
(F):5'- GCTCACTAACTGCCCACTGG -3'
(R):5'- GGTCCATGTCTACTTAGCCAAGATG -3'
Posted On2016-06-06