Incidental Mutation 'R5066:Nfx1'
ID388314
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Namenuclear transcription factor, X-box binding 1
Synonyms1300017N15Rik, Tex42, 3000003M19Rik, TEG-42
MMRRC Submission 042656-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40970906-41025993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40991868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 519 (I519V)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]
Predicted Effect probably benign
Transcript: ENSMUST00000030133
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: I519V

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091614
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: I519V

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098143
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: I519V

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175121
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atp1a1 C T 3: 101,582,104 G731R probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Bcl2l13 T A 6: 120,887,021 V312E possibly damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Flt4 A G 11: 49,634,163 N612S possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mndal C A 1: 173,875,663 A59S probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Sybu A G 15: 44,677,644 C341R probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40977241 missense probably benign 0.00
IGL01998:Nfx1 APN 4 41004353 missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41016119 missense probably benign
IGL02170:Nfx1 APN 4 41018019 missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40993827 missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40976345 splice site probably benign
IGL02674:Nfx1 APN 4 40999717 critical splice donor site probably null
IGL03007:Nfx1 APN 4 40984962 missense probably benign 0.02
IGL03092:Nfx1 APN 4 41024851 missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41004323 splice site probably benign
K7371:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
PIT4498001:Nfx1 UTSW 4 40977244 missense probably benign
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0069:Nfx1 UTSW 4 40986688 splice site probably benign
R1056:Nfx1 UTSW 4 41003057 missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40977004 missense probably benign
R1636:Nfx1 UTSW 4 41016072 splice site probably null
R1882:Nfx1 UTSW 4 41009240 missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R3792:Nfx1 UTSW 4 41004357 nonsense probably null
R3793:Nfx1 UTSW 4 41004357 nonsense probably null
R4668:Nfx1 UTSW 4 40976367 missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41012070 missense probably benign 0.01
R4894:Nfx1 UTSW 4 40996877 missense probably damaging 1.00
R4972:Nfx1 UTSW 4 40976375 missense probably benign 0.36
R5389:Nfx1 UTSW 4 40985000 missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41004343 missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5644:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5915:Nfx1 UTSW 4 40977285 missense probably benign 0.02
R6286:Nfx1 UTSW 4 40986728 missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40976851 missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41021830 missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41016119 missense probably benign
R7916:Nfx1 UTSW 4 40977142 missense probably benign 0.11
R8497:Nfx1 UTSW 4 40976968 missense possibly damaging 0.67
R8799:Nfx1 UTSW 4 41023727 missense probably damaging 1.00
X0025:Nfx1 UTSW 4 40976422 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAGTCTGTGTAGTGGGAACTTC -3'
(R):5'- CTATTCTGAGGCAGGGTCTG -3'

Sequencing Primer
(F):5'- AACTTCGGAGTGATGCATTTG -3'
(R):5'- GTCTGGCTGGATCATGACATACAC -3'
Posted On2016-06-06