Mutagenetix > Incidental Mutation

Incidental Mutation 'R5066:Snd1'

388323

Institutional Source

Beutler Lab

Gene Symbol

Snd1

Ensembl Gene

ENSMUSG00000001424

Gene Name

staphylococcal nuclease and tudor domain containing 1

Synonyms

p100 co-activator, Tudor-SN

MMRRC Submission

042656-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R5066 (G1)

Quality Score

172

Status

Validated

Chromosome

Chromosomal Location

28475139-28935162 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 28888240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 891 (N891K)

Ref Sequence

ENSEMBL: ENSMUSP00000001460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000167201]

AlphaFold

Q78PY7

Predicted Effect

probably damaging
Transcript: ENSMUST00000001460
AA Change: N891K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: N891K

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SNc	525	660	3.82e-45	SMART
TUDOR	728	785	4.8e-19	SMART
Pfam:SNase	835	895	1.3e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165151

Predicted Effect

probably benign
Transcript: ENSMUST00000167201

SMART Domains

Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SCOP:d1sty__	526	592	1e-4	SMART

Meta Mutation Damage Score

0.1577

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	A	T	11: 70,616,591	Y154F	probably benign	Het
Abca5	A	T	11: 110,309,350		probably benign	Het
Agtpbp1	T	A	13: 59,474,550	D11V	probably damaging	Het
Aldh1a2	G	A	9: 71,281,700	A299T	possibly damaging	Het
Apc	T	A	18: 34,316,105	V1984D	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Atp13a2	G	A	4: 141,005,138	V905M	probably damaging	Het
Atp1a1	C	T	3: 101,582,104	G731R	probably damaging	Het
Atrn	T	C	2: 130,994,193	V1131A	possibly damaging	Het
BC049762	A	G	11: 51,254,424	F112S	probably damaging	Het
Bcl2l13	T	A	6: 120,887,021	V312E	possibly damaging	Het
Chic2	A	G	5: 75,027,156	V81A	possibly damaging	Het
Drg1	A	T	11: 3,259,353	I122N	possibly damaging	Het
Flt4	A	G	11: 49,634,163	N612S	possibly damaging	Het
Gm11639	A	G	11: 104,720,664	D444G	probably benign	Het
Hadhb	T	C	5: 30,164,096		probably benign	Het
Heg1	G	T	16: 33,738,671	R856S	probably benign	Het
Ice2	A	C	9: 69,408,291	N143T	probably benign	Het
Igkv8-21	G	A	6: 70,315,443	Q4*	probably null	Het
Lrfn2	T	C	17: 49,096,420	S524P	probably damaging	Het
Mndal	C	A	1: 173,875,663	A59S	probably damaging	Het
Mpp7	T	C	18: 7,513,002	E33G	possibly damaging	Het
Nedd4	T	A	9: 72,710,519	D187E	probably damaging	Het
Nfx1	A	G	4: 40,991,868	I519V	probably benign	Het
Olfr773	T	C	10: 129,186,564	I286V	possibly damaging	Het
Olfr9	G	A	10: 128,990,791	R293Q	probably damaging	Het
Padi1	T	C	4: 140,829,437	N153S	probably damaging	Het
Parp10	A	G	15: 76,240,946		probably benign	Het
Ppil2	A	G	16: 17,109,675	Y18H	probably benign	Het
Setbp1	A	T	18: 78,857,299	M1051K	probably damaging	Het
Slc2a7	T	A	4: 150,160,116	M347K	probably damaging	Het
Slc45a2	C	A	15: 11,012,607	T232K	probably benign	Het
Spata13	T	C	14: 60,750,089	Y899H	possibly damaging	Het
Sult1c1	T	A	17: 53,973,998	I26F	probably damaging	Het
Sybu	A	G	15: 44,677,644	C341R	probably damaging	Het
Syk	T	A	13: 52,641,982	S538T	possibly damaging	Het
Syne2	A	G	12: 75,966,551	T2840A	probably benign	Het
Thsd4	A	G	9: 59,976,332	C924R	probably damaging	Het
Tle1	A	G	4: 72,158,267	S175P	probably benign	Het
Tmbim4	C	T	10: 120,217,632	T112M	probably benign	Het
Tmprss11a	A	G	5: 86,420,000		probably null	Het
Tnc	C	A	4: 63,975,229	D1698Y	probably damaging	Het

Other mutations in Snd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Snd1	APN	6	28512986	critical splice donor site	probably null
IGL00940:Snd1	APN	6	28745175	intron	probably benign
IGL01340:Snd1	APN	6	28883369	missense	probably benign
IGL01892:Snd1	APN	6	28888124	critical splice donor site	probably null
IGL02063:Snd1	APN	6	28526221	unclassified	probably benign
IGL02134:Snd1	APN	6	28880279	missense	possibly damaging	0.81
IGL02366:Snd1	APN	6	28707150	intron	probably benign
PIT4677001:Snd1	UTSW	6	28880296	missense	probably benign	0.01
R0039:Snd1	UTSW	6	28745210	missense	probably damaging	1.00
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0463:Snd1	UTSW	6	28724956	missense	probably benign	0.00
R0576:Snd1	UTSW	6	28886577	missense	probably benign	0.31
R0709:Snd1	UTSW	6	28545470	splice site	probably benign
R0959:Snd1	UTSW	6	28884971	missense	probably benign	0.01
R1698:Snd1	UTSW	6	28888253	nonsense	probably null
R1853:Snd1	UTSW	6	28545564	missense	probably damaging	1.00
R2059:Snd1	UTSW	6	28745207	missense	probably damaging	1.00
R2497:Snd1	UTSW	6	28888079	missense	probably benign
R3832:Snd1	UTSW	6	28531404	splice site	probably benign
R3833:Snd1	UTSW	6	28531404	splice site	probably benign
R4643:Snd1	UTSW	6	28880249	missense	probably benign	0.00
R4665:Snd1	UTSW	6	28707054	missense	probably damaging	1.00
R4843:Snd1	UTSW	6	28668643	missense	probably damaging	1.00
R4884:Snd1	UTSW	6	28526912	missense	possibly damaging	0.94
R4959:Snd1	UTSW	6	28884251	nonsense	probably null
R4973:Snd1	UTSW	6	28884251	nonsense	probably null
R5065:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5067:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5131:Snd1	UTSW	6	28885050	missense	probably damaging	0.99
R5172:Snd1	UTSW	6	28886616	missense	possibly damaging	0.91
R5239:Snd1	UTSW	6	28545525	missense	probably damaging	1.00
R5313:Snd1	UTSW	6	28668601	missense	probably benign	0.15
R5395:Snd1	UTSW	6	28526184	missense	probably damaging	0.99
R5938:Snd1	UTSW	6	28874859	critical splice acceptor site	probably null
R6019:Snd1	UTSW	6	28880234	missense	probably benign	0.00
R6248:Snd1	UTSW	6	28520235	nonsense	probably null
R6337:Snd1	UTSW	6	28888289	missense	probably damaging	1.00
R6810:Snd1	UTSW	6	28668610	missense	probably benign	0.23
R6932:Snd1	UTSW	6	28626101	missense	probably benign	0.42
R7469:Snd1	UTSW	6	28626127	missense	probably damaging	1.00
R7485:Snd1	UTSW	6	28531450	missense	probably benign	0.14
R7571:Snd1	UTSW	6	28526203	missense	possibly damaging	0.81
R7866:Snd1	UTSW	6	28527725	missense	probably damaging	1.00
R8178:Snd1	UTSW	6	28874976	missense	possibly damaging	0.85
R8208:Snd1	UTSW	6	28526055	missense	possibly damaging	0.86
R8526:Snd1	UTSW	6	28745254	missense	probably benign	0.00
R8848:Snd1	UTSW	6	28874963	missense	possibly damaging	0.72
R8854:Snd1	UTSW	6	28526969	missense	probably benign	0.02
R9310:Snd1	UTSW	6	28795937	missense	probably null	1.00
R9326:Snd1	UTSW	6	28795843	nonsense	probably null
R9348:Snd1	UTSW	6	28745207	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCACCTCCATCTTGACC -3'
(R):5'- CACGACAGAGGAGGTTTCTG -3'

Sequencing Primer
(F):5'- AGCACCTCCATCTTGACCACTTC -3'
(R):5'- GGTTTCTGTACACTGAAGCAAGC -3'

Posted On

2016-06-06