Incidental Mutation 'R5066:Bcl2l13'
ID388325
Institutional Source Beutler Lab
Gene Symbol Bcl2l13
Ensembl Gene ENSMUSG00000009112
Gene NameBCL2-like 13 (apoptosis facilitator)
SynonymsBCL-RAMBO, Mil1, Mil-1, E430016C20Rik
MMRRC Submission 042656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120836212-120892842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120887021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 312 (V312E)
Ref Sequence ENSEMBL: ENSMUSP00000009256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009256] [ENSMUST00000160684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009256
AA Change: V312E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009256
Gene: ENSMUSG00000009112
AA Change: V312E

DomainStartEndE-ValueType
low complexity region 51 67 N/A INTRINSIC
BCL 106 197 4.19e0 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160684
SMART Domains Protein: ENSMUSP00000125731
Gene: ENSMUSG00000004446

DomainStartEndE-ValueType
Pfam:BID 1 195 3.8e-93 PFAM
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atp1a1 C T 3: 101,582,104 G731R probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Flt4 A G 11: 49,634,163 N612S possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mndal C A 1: 173,875,663 A59S probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Nfx1 A G 4: 40,991,868 I519V probably benign Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Sybu A G 15: 44,677,644 C341R probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Bcl2l13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02615:Bcl2l13 APN 6 120862867 missense probably damaging 0.98
R1344:Bcl2l13 UTSW 6 120876327 missense probably benign 0.23
R1528:Bcl2l13 UTSW 6 120870794 missense possibly damaging 0.86
R1580:Bcl2l13 UTSW 6 120865714 missense probably benign 0.06
R1743:Bcl2l13 UTSW 6 120848543 nonsense probably null
R4949:Bcl2l13 UTSW 6 120887230 missense probably damaging 1.00
R5470:Bcl2l13 UTSW 6 120862872 missense probably benign 0.07
R6370:Bcl2l13 UTSW 6 120865622 missense probably benign 0.03
R6843:Bcl2l13 UTSW 6 120848617 critical splice donor site probably null
R6866:Bcl2l13 UTSW 6 120862889 missense probably benign 0.07
R7661:Bcl2l13 UTSW 6 120865597 missense possibly damaging 0.53
R7910:Bcl2l13 UTSW 6 120865685 missense possibly damaging 0.87
R7991:Bcl2l13 UTSW 6 120865685 missense possibly damaging 0.87
R8192:Bcl2l13 UTSW 6 120876306 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGACAACATCCTGGCAGTCG -3'
(R):5'- CAAAGAGCAGTACGGCCTTG -3'

Sequencing Primer
(F):5'- CAACATCCTGGCAGTCGGAGAG -3'
(R):5'- TCCTCACTCAGCTGAGCG -3'
Posted On2016-06-06