Incidental Mutation 'R5066:Nedd4'
ID 388329
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Name neural precursor cell expressed, developmentally down-regulated 4
Synonyms E430025J12Rik, Nedd4a, Nedd4, Nedd4-1
MMRRC Submission 042656-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5066 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 72569628-72657134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72617801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 187 (D187E)
Ref Sequence ENSEMBL: ENSMUSP00000034740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]
AlphaFold P46935
PDB Structure Crystal structure of the Nedd4 C2/Grb10 SH2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034740
AA Change: D187E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: D187E

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183375
AA Change: D169E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216
AA Change: D169E

DomainStartEndE-ValueType
C2 79 163 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184333
AA Change: D77E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216
AA Change: D77E

DomainStartEndE-ValueType
C2 4 71 3.38e-4 SMART
WW 140 172 2.32e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184450
AA Change: D187E

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: D187E

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
Meta Mutation Damage Score 0.1475 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,507,417 (GRCm39) Y154F probably benign Het
Abca5 A T 11: 110,200,176 (GRCm39) probably benign Het
Agtpbp1 T A 13: 59,622,364 (GRCm39) D11V probably damaging Het
Aldh1a2 G A 9: 71,188,982 (GRCm39) A299T possibly damaging Het
Apc T A 18: 34,449,158 (GRCm39) V1984D probably damaging Het
Asxl3 C G 18: 22,658,356 (GRCm39) A2122G possibly damaging Het
Atp13a2 G A 4: 140,732,449 (GRCm39) V905M probably damaging Het
Atp1a1 C T 3: 101,489,420 (GRCm39) G731R probably damaging Het
Atrn T C 2: 130,836,113 (GRCm39) V1131A possibly damaging Het
Bcl2l13 T A 6: 120,863,982 (GRCm39) V312E possibly damaging Het
Chic2 A G 5: 75,187,817 (GRCm39) V81A possibly damaging Het
Drg1 A T 11: 3,209,353 (GRCm39) I122N possibly damaging Het
Efcab3 A G 11: 104,611,490 (GRCm39) D444G probably benign Het
Flt4 A G 11: 49,524,990 (GRCm39) N612S possibly damaging Het
Hadhb T C 5: 30,369,094 (GRCm39) probably benign Het
Heg1 G T 16: 33,559,041 (GRCm39) R856S probably benign Het
Ice2 A C 9: 69,315,573 (GRCm39) N143T probably benign Het
Igkv8-21 G A 6: 70,292,427 (GRCm39) Q4* probably null Het
Lrfn2 T C 17: 49,403,448 (GRCm39) S524P probably damaging Het
Mndal C A 1: 173,703,229 (GRCm39) A59S probably damaging Het
Mpp7 T C 18: 7,513,002 (GRCm39) E33G possibly damaging Het
Msantd5l A G 11: 51,145,251 (GRCm39) F112S probably damaging Het
Nfx1 A G 4: 40,991,868 (GRCm39) I519V probably benign Het
Or10p22 G A 10: 128,826,660 (GRCm39) R293Q probably damaging Het
Or6c204 T C 10: 129,022,433 (GRCm39) I286V possibly damaging Het
Padi1 T C 4: 140,556,748 (GRCm39) N153S probably damaging Het
Parp10 A G 15: 76,125,146 (GRCm39) probably benign Het
Setbp1 A T 18: 78,900,514 (GRCm39) M1051K probably damaging Het
Slc2a7 T A 4: 150,244,573 (GRCm39) M347K probably damaging Het
Slc45a2 C A 15: 11,012,693 (GRCm39) T232K probably benign Het
Snd1 C A 6: 28,888,239 (GRCm39) N891K probably damaging Het
Spata13 T C 14: 60,987,538 (GRCm39) Y899H possibly damaging Het
Sult1c2 T A 17: 54,281,026 (GRCm39) I26F probably damaging Het
Sybu A G 15: 44,541,040 (GRCm39) C341R probably damaging Het
Syk T A 13: 52,796,018 (GRCm39) S538T possibly damaging Het
Syne2 A G 12: 76,013,325 (GRCm39) T2840A probably benign Het
Thsd4 A G 9: 59,883,615 (GRCm39) C924R probably damaging Het
Tle1 A G 4: 72,076,504 (GRCm39) S175P probably benign Het
Tmbim4 C T 10: 120,053,537 (GRCm39) T112M probably benign Het
Tmprss11a A G 5: 86,567,859 (GRCm39) probably null Het
Tnc C A 4: 63,893,466 (GRCm39) D1698Y probably damaging Het
Ypel1 A G 16: 16,927,539 (GRCm39) Y18H probably benign Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72,642,371 (GRCm39) missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72,593,338 (GRCm39) splice site probably null
IGL01973:Nedd4 APN 9 72,644,216 (GRCm39) missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72,654,439 (GRCm39) missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72,584,676 (GRCm39) critical splice donor site probably null
Evaporation UTSW 9 72,593,377 (GRCm39) missense probably damaging 1.00
Reduction UTSW 9 72,638,553 (GRCm39) missense possibly damaging 0.49
Snookie UTSW 9 72,632,346 (GRCm39) missense probably benign 0.04
Sublimation UTSW 9 72,584,661 (GRCm39) nonsense probably null
R0194:Nedd4 UTSW 9 72,577,335 (GRCm39) missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72,638,728 (GRCm39) splice site probably benign
R1331:Nedd4 UTSW 9 72,584,668 (GRCm39) missense probably damaging 1.00
R1633:Nedd4 UTSW 9 72,578,539 (GRCm39) missense possibly damaging 0.50
R1764:Nedd4 UTSW 9 72,638,189 (GRCm39) missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72,650,000 (GRCm39) missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72,632,356 (GRCm39) missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72,643,989 (GRCm39) missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72,632,356 (GRCm39) missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72,638,185 (GRCm39) missense probably benign 0.04
R3040:Nedd4 UTSW 9 72,577,243 (GRCm39) missense probably benign
R3697:Nedd4 UTSW 9 72,647,469 (GRCm39) missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72,632,359 (GRCm39) missense probably benign 0.16
R4475:Nedd4 UTSW 9 72,578,521 (GRCm39) nonsense probably null
R4476:Nedd4 UTSW 9 72,578,521 (GRCm39) nonsense probably null
R4883:Nedd4 UTSW 9 72,647,515 (GRCm39) splice site probably null
R5947:Nedd4 UTSW 9 72,638,132 (GRCm39) intron probably benign
R5974:Nedd4 UTSW 9 72,650,920 (GRCm39) critical splice donor site probably null
R6247:Nedd4 UTSW 9 72,633,720 (GRCm39) missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72,638,553 (GRCm39) missense possibly damaging 0.49
R6661:Nedd4 UTSW 9 72,593,377 (GRCm39) missense probably damaging 1.00
R7170:Nedd4 UTSW 9 72,577,381 (GRCm39) missense probably benign 0.00
R7237:Nedd4 UTSW 9 72,632,346 (GRCm39) missense probably benign 0.04
R7653:Nedd4 UTSW 9 72,650,910 (GRCm39) missense probably damaging 1.00
R7772:Nedd4 UTSW 9 72,584,608 (GRCm39) missense possibly damaging 0.77
R7905:Nedd4 UTSW 9 72,584,661 (GRCm39) nonsense probably null
R8194:Nedd4 UTSW 9 72,593,389 (GRCm39) missense probably damaging 1.00
R8229:Nedd4 UTSW 9 72,638,670 (GRCm39) missense probably benign 0.00
R8422:Nedd4 UTSW 9 72,649,964 (GRCm39) missense probably damaging 0.99
R8487:Nedd4 UTSW 9 72,577,321 (GRCm39) missense probably damaging 0.98
R8733:Nedd4 UTSW 9 72,633,766 (GRCm39) missense possibly damaging 0.80
R8956:Nedd4 UTSW 9 72,633,708 (GRCm39) missense probably benign 0.03
R9261:Nedd4 UTSW 9 72,584,656 (GRCm39) missense possibly damaging 0.93
R9447:Nedd4 UTSW 9 72,577,381 (GRCm39) missense probably benign
Z1088:Nedd4 UTSW 9 72,577,360 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAGGAAGCCAAAGCCATGTG -3'
(R):5'- GAGTAAGGTTTAATGAAGACACAAATC -3'

Sequencing Primer
(F):5'- CAAAGCCATGTGGTTACCAGCTG -3'
(R):5'- TACAATTCTTAGCAGCCACATAGG -3'
Posted On 2016-06-06