Incidental Mutation 'R5066:Flt4'
ID388335
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 042656-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5066 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49634163 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 612 (N612S)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020617
AA Change: N612S

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: N612S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A T 11: 70,616,591 Y154F probably benign Het
Abca5 A T 11: 110,309,350 probably benign Het
Agtpbp1 T A 13: 59,474,550 D11V probably damaging Het
Aldh1a2 G A 9: 71,281,700 A299T possibly damaging Het
Apc T A 18: 34,316,105 V1984D probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Atp13a2 G A 4: 141,005,138 V905M probably damaging Het
Atp1a1 C T 3: 101,582,104 G731R probably damaging Het
Atrn T C 2: 130,994,193 V1131A possibly damaging Het
BC049762 A G 11: 51,254,424 F112S probably damaging Het
Bcl2l13 T A 6: 120,887,021 V312E possibly damaging Het
Chic2 A G 5: 75,027,156 V81A possibly damaging Het
Drg1 A T 11: 3,259,353 I122N possibly damaging Het
Gm11639 A G 11: 104,720,664 D444G probably benign Het
Hadhb T C 5: 30,164,096 probably benign Het
Heg1 G T 16: 33,738,671 R856S probably benign Het
Ice2 A C 9: 69,408,291 N143T probably benign Het
Igkv8-21 G A 6: 70,315,443 Q4* probably null Het
Lrfn2 T C 17: 49,096,420 S524P probably damaging Het
Mndal C A 1: 173,875,663 A59S probably damaging Het
Mpp7 T C 18: 7,513,002 E33G possibly damaging Het
Nedd4 T A 9: 72,710,519 D187E probably damaging Het
Nfx1 A G 4: 40,991,868 I519V probably benign Het
Olfr773 T C 10: 129,186,564 I286V possibly damaging Het
Olfr9 G A 10: 128,990,791 R293Q probably damaging Het
Padi1 T C 4: 140,829,437 N153S probably damaging Het
Parp10 A G 15: 76,240,946 probably benign Het
Ppil2 A G 16: 17,109,675 Y18H probably benign Het
Setbp1 A T 18: 78,857,299 M1051K probably damaging Het
Slc2a7 T A 4: 150,160,116 M347K probably damaging Het
Slc45a2 C A 15: 11,012,607 T232K probably benign Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Spata13 T C 14: 60,750,089 Y899H possibly damaging Het
Sult1c1 T A 17: 53,973,998 I26F probably damaging Het
Sybu A G 15: 44,677,644 C341R probably damaging Het
Syk T A 13: 52,641,982 S538T possibly damaging Het
Syne2 A G 12: 75,966,551 T2840A probably benign Het
Thsd4 A G 9: 59,976,332 C924R probably damaging Het
Tle1 A G 4: 72,158,267 S175P probably benign Het
Tmbim4 C T 10: 120,217,632 T112M probably benign Het
Tmprss11a A G 5: 86,420,000 probably null Het
Tnc C A 4: 63,975,229 D1698Y probably damaging Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAAGCAGAGACAGTGTCACTC -3'
(R):5'- CGGACAGGTACTTCTTGTGG -3'

Sequencing Primer
(F):5'- AGAGACAGTGTCACTCGGGTTC -3'
(R):5'- ACAGGTACTTCTTGTGGCAGTG -3'
Posted On2016-06-06