Mutagenetix > Incidental Mutation

Incidental Mutation 'R5066:Mpp7'

388351

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

042656-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R5066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7513002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 33 (E33G)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115869
AA Change: E33G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: E33G

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.1331

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	A	T	11: 70,616,591	Y154F	probably benign	Het
Abca5	A	T	11: 110,309,350		probably benign	Het
Agtpbp1	T	A	13: 59,474,550	D11V	probably damaging	Het
Aldh1a2	G	A	9: 71,281,700	A299T	possibly damaging	Het
Apc	T	A	18: 34,316,105	V1984D	probably damaging	Het
Asxl3	C	G	18: 22,525,299	A2122G	possibly damaging	Het
Atp13a2	G	A	4: 141,005,138	V905M	probably damaging	Het
Atp1a1	C	T	3: 101,582,104	G731R	probably damaging	Het
Atrn	T	C	2: 130,994,193	V1131A	possibly damaging	Het
BC049762	A	G	11: 51,254,424	F112S	probably damaging	Het
Bcl2l13	T	A	6: 120,887,021	V312E	possibly damaging	Het
Chic2	A	G	5: 75,027,156	V81A	possibly damaging	Het
Drg1	A	T	11: 3,259,353	I122N	possibly damaging	Het
Flt4	A	G	11: 49,634,163	N612S	possibly damaging	Het
Gm11639	A	G	11: 104,720,664	D444G	probably benign	Het
Hadhb	T	C	5: 30,164,096		probably benign	Het
Heg1	G	T	16: 33,738,671	R856S	probably benign	Het
Ice2	A	C	9: 69,408,291	N143T	probably benign	Het
Igkv8-21	G	A	6: 70,315,443	Q4*	probably null	Het
Lrfn2	T	C	17: 49,096,420	S524P	probably damaging	Het
Mndal	C	A	1: 173,875,663	A59S	probably damaging	Het
Nedd4	T	A	9: 72,710,519	D187E	probably damaging	Het
Nfx1	A	G	4: 40,991,868	I519V	probably benign	Het
Olfr773	T	C	10: 129,186,564	I286V	possibly damaging	Het
Olfr9	G	A	10: 128,990,791	R293Q	probably damaging	Het
Padi1	T	C	4: 140,829,437	N153S	probably damaging	Het
Parp10	A	G	15: 76,240,946		probably benign	Het
Ppil2	A	G	16: 17,109,675	Y18H	probably benign	Het
Setbp1	A	T	18: 78,857,299	M1051K	probably damaging	Het
Slc2a7	T	A	4: 150,160,116	M347K	probably damaging	Het
Slc45a2	C	A	15: 11,012,607	T232K	probably benign	Het
Snd1	C	A	6: 28,888,240	N891K	probably damaging	Het
Spata13	T	C	14: 60,750,089	Y899H	possibly damaging	Het
Sult1c1	T	A	17: 53,973,998	I26F	probably damaging	Het
Sybu	A	G	15: 44,677,644	C341R	probably damaging	Het
Syk	T	A	13: 52,641,982	S538T	possibly damaging	Het
Syne2	A	G	12: 75,966,551	T2840A	probably benign	Het
Thsd4	A	G	9: 59,976,332	C924R	probably damaging	Het
Tle1	A	G	4: 72,158,267	S175P	probably benign	Het
Tmbim4	C	T	10: 120,217,632	T112M	probably benign	Het
Tmprss11a	A	G	5: 86,420,000		probably null	Het
Tnc	C	A	4: 63,975,229	D1698Y	probably damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCCCTTCAGTGAAGTCAC -3'
(R):5'- TGCTTGACGGCCCAGAATAAATC -3'

Sequencing Primer
(F):5'- GAAGTCACCTATGTATTTCTGGTAAG -3'
(R):5'- TCCAGTAAAAGTGACATGTTCCAGC -3'

Posted On

2016-06-06