Incidental Mutation 'R5067:Cfap61'
ID388360
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Namecilia and flagella associated protein 61
Synonyms4930529M08Rik
MMRRC Submission 042657-MU
Accession Numbers

Genbank: NM_175280.3; Ensemble: ENSMUST00000133433

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145934784-146215039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146102036 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 134 (D134G)
Ref Sequence ENSEMBL: ENSMUSP00000121560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125223] [ENSMUST00000133433]
Predicted Effect probably damaging
Transcript: ENSMUST00000125223
AA Change: D134G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121560
Gene: ENSMUSG00000037143
AA Change: D134G

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133433
AA Change: D741G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143
AA Change: D741G

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150771
Meta Mutation Damage Score 0.2686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145947164 nonsense probably null
IGL03024:Cfap61 APN 2 145939999 splice site probably benign
1mM(1):Cfap61 UTSW 2 146200760 missense probably damaging 1.00
R0006:Cfap61 UTSW 2 146077312 missense probably benign 0.06
R0396:Cfap61 UTSW 2 145949944 missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 146008917 missense probably benign 0.08
R0477:Cfap61 UTSW 2 145939916 missense probably damaging 1.00
R0513:Cfap61 UTSW 2 146035295 missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145951061 nonsense probably null
R1413:Cfap61 UTSW 2 145963443 missense probably benign 0.27
R1591:Cfap61 UTSW 2 146145458 missense probably benign 0.17
R1599:Cfap61 UTSW 2 146012163 missense probably benign
R1661:Cfap61 UTSW 2 146035319 splice site probably null
R1665:Cfap61 UTSW 2 146035319 splice site probably null
R1789:Cfap61 UTSW 2 145939993 critical splice donor site probably null
R1800:Cfap61 UTSW 2 146042622 missense probably damaging 1.00
R2050:Cfap61 UTSW 2 146145473 missense probably benign 0.26
R2202:Cfap61 UTSW 2 146214680 missense probably damaging 1.00
R2220:Cfap61 UTSW 2 146036816 critical splice acceptor site probably null
R2444:Cfap61 UTSW 2 146035319 splice site probably null
R3779:Cfap61 UTSW 2 145950794 missense probably damaging 1.00
R4668:Cfap61 UTSW 2 146143136 missense probably damaging 0.99
R4705:Cfap61 UTSW 2 146035202 missense probably damaging 1.00
R4763:Cfap61 UTSW 2 146017367 missense probably benign 0.00
R4816:Cfap61 UTSW 2 146143100 missense probably damaging 1.00
R5120:Cfap61 UTSW 2 146143160 nonsense probably null
R5308:Cfap61 UTSW 2 146109988 missense probably damaging 0.99
R5575:Cfap61 UTSW 2 146017393 missense probably benign 0.31
R5834:Cfap61 UTSW 2 146129149 missense probably benign 0.29
R5959:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6190:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6283:Cfap61 UTSW 2 146129102 splice site probably null
R6786:Cfap61 UTSW 2 146045443 missense possibly damaging 0.84
R6933:Cfap61 UTSW 2 145951050 splice site probably null
R7071:Cfap61 UTSW 2 146001912 missense probably benign 0.02
R7132:Cfap61 UTSW 2 146109950 missense probably damaging 0.97
R7312:Cfap61 UTSW 2 146045470 nonsense probably null
R7390:Cfap61 UTSW 2 146001882 missense probably benign 0.00
R7446:Cfap61 UTSW 2 146153838 missense probably benign 0.00
R7515:Cfap61 UTSW 2 146042725 missense unknown
R7608:Cfap61 UTSW 2 145963531 missense possibly damaging 0.73
R7609:Cfap61 UTSW 2 146112533 missense unknown
R7780:Cfap61 UTSW 2 146153772 missense possibly damaging 0.77
R7908:Cfap61 UTSW 2 146102099 missense probably damaging 1.00
R7938:Cfap61 UTSW 2 146045456 missense probably benign 0.09
R8054:Cfap61 UTSW 2 145973518 missense probably damaging 1.00
R8153:Cfap61 UTSW 2 146200784 missense probably benign 0.26
R8195:Cfap61 UTSW 2 145947175 missense probably benign
R8224:Cfap61 UTSW 2 145939880 missense probably benign
R8411:Cfap61 UTSW 2 145947183 missense probably benign 0.01
X0022:Cfap61 UTSW 2 146129090 missense probably benign 0.28
Z1088:Cfap61 UTSW 2 146129227 missense probably benign 0.27
Z1177:Cfap61 UTSW 2 146012162 missense possibly damaging 0.77
Z1177:Cfap61 UTSW 2 146153800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCACTAGGGGACTTGAAC -3'
(R):5'- AATACAGACTGGCAGCTGTG -3'

Sequencing Primer
(F):5'- TTGAACCAGCTTGCCAGATG -3'
(R):5'- GCTCTTTACTCAGAGAGTATGCAC -3'
Posted On2016-06-06