Incidental Mutation 'R5067:Fbxl5'
ID388363
Institutional Source Beutler Lab
Gene Symbol Fbxl5
Ensembl Gene ENSMUSG00000039753
Gene NameF-box and leucine-rich repeat protein 5
SynonymsFbl4, Fir4
MMRRC Submission 042657-MU
Accession Numbers

Genbank: NM_001159963.1, NM_178729.4; Ensemble: ENSMUST00000114047, ENSMUST00000114047, ENSMUST00000119523, ENSMUST00000141902, ENSMUST00000087465, ENSMUST00000121736, ENSMUST00000124610                                     

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43744615-43821638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43758772 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 432 (K432E)
Ref Sequence ENSEMBL: ENSMUSP00000143703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000087465] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000121736] [ENSMUST00000124610] [ENSMUST00000196483]
Predicted Effect probably benign
Transcript: ENSMUST00000047857
AA Change: K433E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753
AA Change: K433E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000087465
AA Change: K433E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084733
Gene: ENSMUSG00000039753
AA Change: K433E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 4.3e-15 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114047
AA Change: K427E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753
AA Change: K427E

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119523
AA Change: K416E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753
AA Change: K416E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121736
AA Change: K390E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112444
Gene: ENSMUSG00000039753
AA Change: K390E

DomainStartEndE-ValueType
PDB:3V5Z|B 1 118 2e-71 PDB
FBOX 165 205 2.31e-9 SMART
low complexity region 246 267 N/A INTRINSIC
LRR 312 336 2.43e2 SMART
LRR 339 364 4.87e-4 SMART
low complexity region 438 449 N/A INTRINSIC
LRR 553 578 1.23e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124421
Predicted Effect probably benign
Transcript: ENSMUST00000124610
AA Change: K433E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116720
Gene: ENSMUSG00000039753
AA Change: K433E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 5.7e-12 PFAM
FBOX 208 248 1.5e-11 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 1e0 SMART
LRR 382 407 2e-6 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1e-2 SMART
LRR 624 649 1.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140469
Predicted Effect unknown
Transcript: ENSMUST00000141902
AA Change: K353E
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753
AA Change: K353E

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143316
Predicted Effect probably benign
Transcript: ENSMUST00000196483
AA Change: K432E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753
AA Change: K432E

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196543
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before turning of the embryo with iron overload, growth retardation, and hemorrhage. Mice heterozygous for a knock-out allele exhibit abnormal iron homeostasis when fed a low iron diet. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Fbxl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fbxl5 APN 5 43765336 missense probably damaging 1.00
IGL00797:Fbxl5 APN 5 43758401 missense probably damaging 1.00
IGL00811:Fbxl5 APN 5 43758225 missense probably damaging 1.00
IGL01065:Fbxl5 APN 5 43745334 missense probably damaging 1.00
IGL01626:Fbxl5 APN 5 43758705 missense probably benign 0.00
IGL02285:Fbxl5 APN 5 43765348 missense possibly damaging 0.88
D3080:Fbxl5 UTSW 5 43758366 missense probably benign 0.00
PIT4498001:Fbxl5 UTSW 5 43750981 missense possibly damaging 0.73
R0195:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R0647:Fbxl5 UTSW 5 43768069 missense probably damaging 0.98
R1540:Fbxl5 UTSW 5 43758636 missense possibly damaging 0.92
R1545:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R1569:Fbxl5 UTSW 5 43765461 missense probably damaging 1.00
R1921:Fbxl5 UTSW 5 43765490 missense probably benign 0.16
R3081:Fbxl5 UTSW 5 43750880 missense probably damaging 1.00
R3776:Fbxl5 UTSW 5 43758276 missense possibly damaging 0.57
R4096:Fbxl5 UTSW 5 43758241 missense probably benign 0.19
R4275:Fbxl5 UTSW 5 43762772 intron probably benign
R4383:Fbxl5 UTSW 5 43762963 intron probably benign
R4469:Fbxl5 UTSW 5 43768186 missense probably damaging 1.00
R4654:Fbxl5 UTSW 5 43765429 missense probably damaging 0.99
R5093:Fbxl5 UTSW 5 43773554 missense probably damaging 1.00
R5696:Fbxl5 UTSW 5 43758840 missense possibly damaging 0.93
R5738:Fbxl5 UTSW 5 43762828 missense probably benign 0.30
R6029:Fbxl5 UTSW 5 43765404 missense probably damaging 0.96
R6185:Fbxl5 UTSW 5 43821552 missense probably benign 0.02
R6842:Fbxl5 UTSW 5 43773586 missense probably damaging 1.00
R7234:Fbxl5 UTSW 5 43758220 missense probably benign 0.08
R7563:Fbxl5 UTSW 5 43821549 missense probably benign 0.00
R7653:Fbxl5 UTSW 5 43758774 missense probably benign
R7842:Fbxl5 UTSW 5 43758603 missense probably damaging 1.00
R7860:Fbxl5 UTSW 5 43758676 missense probably benign 0.00
R8139:Fbxl5 UTSW 5 43758745 nonsense probably null
R8393:Fbxl5 UTSW 5 43768091 missense possibly damaging 0.94
RF012:Fbxl5 UTSW 5 43773505 missense probably damaging 1.00
X0065:Fbxl5 UTSW 5 43760798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTCCATCACACAGAGAC -3'
(R):5'- CCCTCTTGTAGTTGGTCTTGGC -3'

Sequencing Primer
(F):5'- CACAGAGACTCTCAACATTTCTGTG -3'
(R):5'- CTCGGTTGCTGCCAGAGTC -3'
Posted On2016-06-06