Incidental Mutation 'R5067:Btbd10'
ID388368
Institutional Source Beutler Lab
Gene Symbol Btbd10
Ensembl Gene ENSMUSG00000038187
Gene NameBTB (POZ) domain containing 10
SynonymsGmrp1, 1110056N09Rik
MMRRC Submission 042657-MU
Accession Numbers

Ncbi RefSeq: NM_133700.2; MGI:1916065

Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113315626-113369392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113325836 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 268 (D268E)
Ref Sequence ENSEMBL: ENSMUSP00000113632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047091] [ENSMUST00000117577] [ENSMUST00000119278] [ENSMUST00000135510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047091
AA Change: D316E

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048530
Gene: ENSMUSG00000038187
AA Change: D316E

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
BTB 167 272 1.58e-4 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117577
AA Change: D324E

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113496
Gene: ENSMUSG00000038187
AA Change: D324E

DomainStartEndE-ValueType
low complexity region 68 83 N/A INTRINSIC
low complexity region 114 155 N/A INTRINSIC
BTB 175 280 1.58e-4 SMART
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118029
Predicted Effect probably damaging
Transcript: ENSMUST00000119278
AA Change: D268E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113632
Gene: ENSMUSG00000038187
AA Change: D268E

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 58 99 N/A INTRINSIC
BTB 119 224 1.58e-4 SMART
low complexity region 263 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135510
SMART Domains Protein: ENSMUSP00000114806
Gene: ENSMUSG00000038187

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
SCOP:d1t1da_ 167 198 3e-6 SMART
Blast:BTB 167 200 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139650
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Btbd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Btbd10 APN 7 113316556 missense probably damaging 1.00
IGL03223:Btbd10 APN 7 113332670 missense probably damaging 1.00
I1329:Btbd10 UTSW 7 113332875 missense probably benign 0.00
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0136:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0299:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0599:Btbd10 UTSW 7 113335309 splice site probably benign
R0657:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R1401:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R2916:Btbd10 UTSW 7 113332824 missense probably benign
R3429:Btbd10 UTSW 7 113351809 nonsense probably null
R3430:Btbd10 UTSW 7 113351809 nonsense probably null
R4578:Btbd10 UTSW 7 113322752 missense possibly damaging 0.93
R4626:Btbd10 UTSW 7 113328398 missense probably damaging 0.96
R5480:Btbd10 UTSW 7 113316707 missense probably damaging 1.00
R5667:Btbd10 UTSW 7 113332724 missense probably damaging 1.00
R6468:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R6877:Btbd10 UTSW 7 113322760 missense probably damaging 1.00
R6952:Btbd10 UTSW 7 113351943 splice site probably null
R7059:Btbd10 UTSW 7 113329922 missense probably damaging 0.97
R8175:Btbd10 UTSW 7 113322792 critical splice acceptor site probably null
X0027:Btbd10 UTSW 7 113316698 missense probably damaging 1.00
Z1177:Btbd10 UTSW 7 113332689 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAGAGCTAGTTTGGTCCCTGG -3'
(R):5'- TGTCCATATTTTGCTCAGACTGTG -3'

Sequencing Primer
(F):5'- CTAGTTTGGTCCCTGGGGTAG -3'
(R):5'- GCTTTTATCAGGCATCCAAAAATGTC -3'
Posted On2016-06-06