Incidental Mutation 'R5067:Trim72'
ID388369
Institutional Source Beutler Lab
Gene Symbol Trim72
Ensembl Gene ENSMUSG00000042828
Gene Nametripartite motif-containing 72
Synonymsmitsugumin 53, MG53
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5067 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location128003949-128011033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128009967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 314 (S314P)
Ref Sequence ENSEMBL: ENSMUSP00000101855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081042
AA Change: S314P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: S314P

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 342 472 4.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106248
AA Change: S314P

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: S314P

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 344 465 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206996
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Trim72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Trim72 APN 7 128007964 missense probably damaging 0.97
IGL02538:Trim72 APN 7 128004770 missense probably damaging 1.00
IGL02794:Trim72 APN 7 128004532 missense probably damaging 1.00
IGL03077:Trim72 APN 7 128007841 missense probably benign
H8786:Trim72 UTSW 7 128004791 missense probably damaging 0.99
R1101:Trim72 UTSW 7 128010247 missense possibly damaging 0.94
R1711:Trim72 UTSW 7 128004585 missense probably damaging 1.00
R1826:Trim72 UTSW 7 128007844 missense possibly damaging 0.59
R1853:Trim72 UTSW 7 128009082 missense probably benign 0.01
R1854:Trim72 UTSW 7 128009082 missense probably benign 0.01
R2513:Trim72 UTSW 7 128004706 missense possibly damaging 0.93
R4163:Trim72 UTSW 7 128007908 missense probably benign 0.05
R4587:Trim72 UTSW 7 128007992 missense probably benign 0.21
R5027:Trim72 UTSW 7 128007965 missense probably damaging 0.99
R5276:Trim72 UTSW 7 128004542 missense probably damaging 1.00
R5290:Trim72 UTSW 7 128010004 missense probably benign 0.03
R5339:Trim72 UTSW 7 128010333 missense probably benign
R5410:Trim72 UTSW 7 128009923 missense probably damaging 1.00
R6301:Trim72 UTSW 7 128004614 missense possibly damaging 0.93
R6594:Trim72 UTSW 7 128010048 missense probably damaging 1.00
R6774:Trim72 UTSW 7 128010386 missense probably damaging 1.00
R7162:Trim72 UTSW 7 128007649 missense probably benign 0.18
R7372:Trim72 UTSW 7 128004686 missense possibly damaging 0.63
R7937:Trim72 UTSW 7 128010319 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACTGTGTAGCCGAGGAGAG -3'
(R):5'- CTTAGGTAGAGGCCAATGCG -3'

Sequencing Primer
(F):5'- GGGGGAGAGGAGTCTAAGGTCC -3'
(R):5'- ATCTTGCCATCGCGCAGAC -3'
Posted On2016-06-06