Incidental Mutation 'R0432:Man2c1'
ID38837
Institutional Source Beutler Lab
Gene Symbol Man2c1
Ensembl Gene ENSMUSG00000032295
Gene Namemannosidase, alpha, class 2C, member 1
Synonyms
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57130690-57142722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57135597 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 250 (H250Q)
Ref Sequence ENSEMBL: ENSMUSP00000124124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161338] [ENSMUST00000161393] [ENSMUST00000161663] [ENSMUST00000162915]
Predicted Effect probably damaging
Transcript: ENSMUST00000034836
AA Change: H250Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295
AA Change: H250Q

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142077
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160122
Predicted Effect probably damaging
Transcript: ENSMUST00000160147
AA Change: H250Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295
AA Change: H250Q

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161338
AA Change: H2Q
Predicted Effect probably benign
Transcript: ENSMUST00000161393
Predicted Effect probably damaging
Transcript: ENSMUST00000161663
AA Change: H250Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295
AA Change: H250Q

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162738
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
MGI Phenotype PHENOTYPE: Germ line null mutants display neuronal and glia degeneration, glycogen accumulation, and liver and kidney damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Ahctf1 A C 1: 179,784,161 I548R probably damaging Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Clasp2 A G 9: 113,909,419 T423A probably benign Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Dnmbp A T 19: 43,854,857 Y432* probably null Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr49 G T 3: 75,450,022 R285S possibly damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Man2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Man2c1 APN 9 57141819 missense probably benign
IGL01408:Man2c1 APN 9 57141600 missense probably damaging 1.00
IGL01618:Man2c1 APN 9 57141556 unclassified probably benign
IGL01750:Man2c1 APN 9 57140780 critical splice donor site probably null
IGL01796:Man2c1 APN 9 57137960 missense possibly damaging 0.52
IGL02661:Man2c1 APN 9 57137482 missense probably damaging 1.00
IGL03166:Man2c1 APN 9 57139098 missense probably damaging 1.00
IGL03176:Man2c1 APN 9 57140746 missense probably benign 0.05
IGL03209:Man2c1 APN 9 57141830 missense probably benign 0.00
R0014:Man2c1 UTSW 9 57139701 missense probably benign 0.00
R0329:Man2c1 UTSW 9 57141183 missense probably benign 0.40
R1448:Man2c1 UTSW 9 57135219 missense probably benign 0.23
R1616:Man2c1 UTSW 9 57135509 missense probably benign 0.00
R1838:Man2c1 UTSW 9 57137337 missense probably benign 0.07
R2511:Man2c1 UTSW 9 57141388 splice site probably null
R3751:Man2c1 UTSW 9 57140774 missense probably damaging 1.00
R3771:Man2c1 UTSW 9 57140377 unclassified probably benign
R3772:Man2c1 UTSW 9 57140377 unclassified probably benign
R4110:Man2c1 UTSW 9 57136771 missense probably damaging 0.98
R4116:Man2c1 UTSW 9 57140305 critical splice donor site probably null
R4167:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4169:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4170:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4405:Man2c1 UTSW 9 57139083 missense probably damaging 0.98
R4551:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
R4618:Man2c1 UTSW 9 57142155 unclassified probably null
R4798:Man2c1 UTSW 9 57141185 nonsense probably null
R4903:Man2c1 UTSW 9 57138956 missense probably benign 0.08
R5030:Man2c1 UTSW 9 57140639 missense probably benign 0.00
R5079:Man2c1 UTSW 9 57136716 missense probably damaging 1.00
R5086:Man2c1 UTSW 9 57131640 missense probably damaging 0.96
R6430:Man2c1 UTSW 9 57131233 missense possibly damaging 0.91
R6695:Man2c1 UTSW 9 57141591 missense probably benign 0.03
R6743:Man2c1 UTSW 9 57135565 missense probably benign 0.41
R7011:Man2c1 UTSW 9 57137833 missense probably damaging 1.00
R7493:Man2c1 UTSW 9 57141128 missense probably damaging 0.98
R7513:Man2c1 UTSW 9 57139399 missense probably benign 0.44
R7527:Man2c1 UTSW 9 57137816 nonsense probably null
R7540:Man2c1 UTSW 9 57140275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAGACCAGCTAGAGCCTTGC -3'
(R):5'- ACGGAGCCCATGATCTAATGTCCC -3'

Sequencing Primer
(F):5'- GAGGAGTCTTTTAAAGTACAGAACCC -3'
(R):5'- TGTCCCTGATTTATTTTACACAAGTG -3'
Posted On2013-05-23