Incidental Mutation 'R5067:Fam196a'
ID388370
Institutional Source Beutler Lab
Gene Symbol Fam196a
Ensembl Gene ENSMUSG00000073805
Gene Namefamily with sequence similarity 196, member A
Synonyms
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5067 (G1)
Quality Score214
Status Validated
Chromosome7
Chromosomal Location134881926-134938430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134918555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 82 (V82E)
Ref Sequence ENSEMBL: ENSMUSP00000129222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000171394]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171394
AA Change: V82E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129222
Gene: ENSMUSG00000073805
AA Change: V82E

DomainStartEndE-ValueType
Pfam:FAM196 1 470 4.7e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Fam196a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Fam196a APN 7 134917940 missense probably benign 0.15
IGL02380:Fam196a APN 7 134899144 critical splice donor site probably null
R0557:Fam196a UTSW 7 134918705 missense probably damaging 1.00
R1421:Fam196a UTSW 7 134899231 splice site probably benign
R1691:Fam196a UTSW 7 134918286 missense probably damaging 1.00
R1726:Fam196a UTSW 7 134899138 splice site probably benign
R2045:Fam196a UTSW 7 134918430 missense probably damaging 1.00
R2259:Fam196a UTSW 7 134917667 missense probably damaging 1.00
R3078:Fam196a UTSW 7 134918021 missense probably benign 0.15
R3851:Fam196a UTSW 7 134884526 missense probably benign 0.23
R4619:Fam196a UTSW 7 134918541 missense probably damaging 1.00
R4663:Fam196a UTSW 7 134899148 nonsense probably null
R5024:Fam196a UTSW 7 134918478 missense probably damaging 1.00
R5195:Fam196a UTSW 7 134884416 missense probably damaging 1.00
R5708:Fam196a UTSW 7 134918796 missense probably damaging 1.00
R6195:Fam196a UTSW 7 134918648 missense probably damaging 1.00
R7151:Fam196a UTSW 7 134918645 missense probably damaging 1.00
R7414:Fam196a UTSW 7 134918009 missense probably benign 0.06
R7988:Fam196a UTSW 7 134917698 missense probably damaging 1.00
Z1176:Fam196a UTSW 7 134918706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTGAAGGCATCTGCAG -3'
(R):5'- CTCTGGCAGATGCATACTCACG -3'

Sequencing Primer
(F):5'- AGGCATCTGCAGCCGGC -3'
(R):5'- TCACGACACCAGAGCGG -3'
Posted On2016-06-06