Incidental Mutation 'R5067:Defb11'
ID388372
Institutional Source Beutler Lab
Gene Symbol Defb11
Ensembl Gene ENSMUSG00000045337
Gene Namedefensin beta 11
SynonymsDefb8
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location21905376-21906412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21906336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 15 (F15Y)
Ref Sequence ENSEMBL: ENSMUSP00000053932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051965]
Predicted Effect probably damaging
Transcript: ENSMUST00000051965
AA Change: F15Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053932
Gene: ENSMUSG00000045337
AA Change: F15Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DEFSN 37 67 3.54e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212313
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Defb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Defb11 APN 8 21905494 missense probably benign 0.01
R2269:Defb11 UTSW 8 21905428 makesense probably null
R5826:Defb11 UTSW 8 21905494 missense probably benign 0.01
R7252:Defb11 UTSW 8 21905457 missense probably benign 0.00
X0064:Defb11 UTSW 8 21906346 missense probably null 0.96
Z1177:Defb11 UTSW 8 21906346 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGAAGAATCCCTTTGCTACAAG -3'
(R):5'- GCAGAGCTTAGCATGAACAC -3'

Sequencing Primer
(F):5'- AAGACTTTCCTCCATGTCAGGCATAG -3'
(R):5'- GCACTGGAAATGCCTCAGGAC -3'
Posted On2016-06-06