Incidental Mutation 'R5067:Ttc41'
ID388376
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Nametetratricopeptide repeat domain 41
SynonymsGnn, BC030307
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86705811-86776844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86744544 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 785 (S785P)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: S785P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: S785P

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTAACTTCCTTCAGCCATGAG -3'
(R):5'- TCAGCACCATGAAGAGGCAG -3'

Sequencing Primer
(F):5'- GCCATGAGTAACTTACATAATCACG -3'
(R):5'- GAATATAGGCCTAGCGCTAGCC -3'
Posted On2016-06-06