Incidental Mutation 'R5067:Ube2z'
ID388378
Institutional Source Beutler Lab
Gene Symbol Ube2z
Ensembl Gene ENSMUSG00000014349
Gene Nameubiquitin-conjugating enzyme E2Z
Synonyms
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96047432-96065388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96063009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 128 (V128I)
Ref Sequence ENSEMBL: ENSMUSP00000098097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100528]
Predicted Effect probably benign
Transcript: ENSMUST00000100528
AA Change: V128I

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098097
Gene: ENSMUSG00000014349
AA Change: V128I

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 84 N/A INTRINSIC
UBCc 104 255 2.26e-35 SMART
low complexity region 338 344 N/A INTRINSIC
Meta Mutation Damage Score 0.0786 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Ube2z
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ube2z APN 11 96063023 missense probably damaging 1.00
IGL01903:Ube2z APN 11 96065000 missense possibly damaging 0.67
ub40 UTSW 11 96050407 missense probably damaging 1.00
R0501:Ube2z UTSW 11 96050288 missense probably damaging 0.99
R4035:Ube2z UTSW 11 96061067 missense probably damaging 1.00
R5033:Ube2z UTSW 11 96050322 missense probably benign
R5913:Ube2z UTSW 11 96061063 missense possibly damaging 0.56
R6284:Ube2z UTSW 11 96050407 missense probably damaging 1.00
R7447:Ube2z UTSW 11 96055910 missense possibly damaging 0.84
R8134:Ube2z UTSW 11 96058374 missense possibly damaging 0.95
X0019:Ube2z UTSW 11 96065111 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTGTACCCTAACAACAGACC -3'
(R):5'- GTGCAAACATTTTCAGTACCAAGC -3'

Sequencing Primer
(F):5'- CAACAGACCTATTTAAAATTCTGCAC -3'
(R):5'- TTCAGTACCAAGCACCACTTTC -3'
Posted On2016-06-06