Incidental Mutation 'R5067:March10'
ID388381
Institutional Source Beutler Lab
Gene Symbol March10
Ensembl Gene ENSMUSG00000078627
Gene Namemembrane-associated ring finger (C3HC4) 10
Synonyms4933417C16Rik, OTTMUSG00000002847, Rnf190
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105360798-105456735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105390107 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 451 (T451S)
Ref Sequence ENSEMBL: ENSMUSP00000121919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049995] [ENSMUST00000138977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049995
AA Change: T451S

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063198
Gene: ENSMUSG00000078627
AA Change: T451S

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138977
AA Change: T451S

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121919
Gene: ENSMUSG00000078627
AA Change: T451S

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153672
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in March10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:March10 APN 11 105402188 missense possibly damaging 0.82
IGL01461:March10 APN 11 105389605 missense probably damaging 1.00
IGL01473:March10 APN 11 105389605 missense probably damaging 1.00
Forward UTSW 11 105382237 missense probably damaging 1.00
PIT4142001:March10 UTSW 11 105390520 missense probably benign 0.17
R0195:March10 UTSW 11 105385525 missense probably damaging 1.00
R0520:March10 UTSW 11 105389882 missense probably benign
R0628:March10 UTSW 11 105390160 missense probably benign 0.00
R1087:March10 UTSW 11 105390662 missense probably damaging 1.00
R1440:March10 UTSW 11 105390583 missense probably damaging 1.00
R1802:March10 UTSW 11 105389915 missense probably benign 0.00
R1855:March10 UTSW 11 105390392 missense probably benign
R1860:March10 UTSW 11 105397078 missense probably damaging 0.99
R2504:March10 UTSW 11 105385572 missense probably damaging 1.00
R3788:March10 UTSW 11 105397079 missense probably damaging 1.00
R4629:March10 UTSW 11 105389838 missense probably benign 0.28
R4755:March10 UTSW 11 105364476 intron probably benign
R4776:March10 UTSW 11 105390037 missense probably benign 0.42
R5192:March10 UTSW 11 105371926 missense possibly damaging 0.68
R5436:March10 UTSW 11 105402165 missense possibly damaging 0.92
R5541:March10 UTSW 11 105390131 missense probably damaging 1.00
R5888:March10 UTSW 11 105402146 missense possibly damaging 0.92
R5908:March10 UTSW 11 105390239 missense probably benign 0.00
R5914:March10 UTSW 11 105385482 missense probably damaging 1.00
R6038:March10 UTSW 11 105402051 missense probably damaging 0.96
R6178:March10 UTSW 11 105389614 missense probably damaging 1.00
R6300:March10 UTSW 11 105382237 missense probably damaging 1.00
R6612:March10 UTSW 11 105397078 missense probably damaging 0.99
R6894:March10 UTSW 11 105396961 missense possibly damaging 0.94
R6921:March10 UTSW 11 105389777 missense probably benign 0.00
R7134:March10 UTSW 11 105408676 missense probably benign
R7199:March10 UTSW 11 105390706 missense probably damaging 0.99
R7546:March10 UTSW 11 105390080 missense not run
R7792:March10 UTSW 11 105390228 missense probably benign
R8241:March10 UTSW 11 105389915 missense probably benign 0.00
Z1088:March10 UTSW 11 105390359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTGGGCTTCATCACTG -3'
(R):5'- TGAGAAGACCCCTGTTCTAGG -3'

Sequencing Primer
(F):5'- AGCAGCGGCCAATGGATTTC -3'
(R):5'- CCTGTTCTAGGGGATGCGAAATC -3'
Posted On2016-06-06