Incidental Mutation 'R5067:Gm8674'
ID388384
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Namepredicted gene 8674
Synonyms
MMRRC Submission 042657-MU
Accession Numbers

Genbank: XM_990959; MGI: 3645762

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49899119-49904597 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 49899834 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 49901939 exon noncoding transcript
R0357:Gm8674 UTSW 13 49902113 exon noncoding transcript
R0627:Gm8674 UTSW 13 49899715 exon noncoding transcript
R0833:Gm8674 UTSW 13 49904575 exon noncoding transcript
R1300:Gm8674 UTSW 13 49901722 exon noncoding transcript
R1452:Gm8674 UTSW 13 49900517 exon noncoding transcript
R1542:Gm8674 UTSW 13 49900003 exon noncoding transcript
R1613:Gm8674 UTSW 13 49902438 intron noncoding transcript
R1643:Gm8674 UTSW 13 49901358 exon noncoding transcript
R1732:Gm8674 UTSW 13 49901926 exon noncoding transcript
R1824:Gm8674 UTSW 13 49900808 exon noncoding transcript
R1840:Gm8674 UTSW 13 49901765 exon noncoding transcript
R1915:Gm8674 UTSW 13 49900853 exon noncoding transcript
R1934:Gm8674 UTSW 13 49901435 exon noncoding transcript
R2040:Gm8674 UTSW 13 49901669 exon noncoding transcript
R2214:Gm8674 UTSW 13 49901360 exon noncoding transcript
R2421:Gm8674 UTSW 13 49900663 exon noncoding transcript
R3423:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3425:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3886:Gm8674 UTSW 13 49902163 splice site noncoding transcript
R4083:Gm8674 UTSW 13 49901011 exon noncoding transcript
R4343:Gm8674 UTSW 13 49899706 exon noncoding transcript
R4570:Gm8674 UTSW 13 49902534 intron noncoding transcript
R4936:Gm8674 UTSW 13 49900755 exon noncoding transcript
R4967:Gm8674 UTSW 13 49901998 exon noncoding transcript
R5065:Gm8674 UTSW 13 49902577 intron noncoding transcript
R5120:Gm8674 UTSW 13 49901948 exon noncoding transcript
R5208:Gm8674 UTSW 13 49901921 exon noncoding transcript
R5268:Gm8674 UTSW 13 49901354 exon noncoding transcript
R5471:Gm8674 UTSW 13 49900813 exon noncoding transcript
R5773:Gm8674 UTSW 13 49901876 exon noncoding transcript
R5809:Gm8674 UTSW 13 49901888 exon noncoding transcript
R8162:Gm8674 UTSW 13 49900371 missense noncoding transcript
R8239:Gm8674 UTSW 13 49900226 missense noncoding transcript
Z1088:Gm8674 UTSW 13 49900794 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49901248 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTATGCATCTCAGGGCTGGC -3'
(R):5'- CTCAAGGCTGCAGAAAAGAC -3'

Sequencing Primer
(F):5'- CATGGCCACAGATCCTCCTG -3'
(R):5'- GAGGCTACTTCTCAAAACCCCTGG -3'
Posted On2016-06-06