Incidental Mutation 'R5067:Nfatc4'
ID388385
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms3110041H08Rik
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55823144-55833943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55832418 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 681 (Q681L)
Ref Sequence ENSEMBL: ENSMUSP00000154682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357]
Predicted Effect probably damaging
Transcript: ENSMUST00000024179
AA Change: Q751L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: Q751L

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172271
AA Change: Q751L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: Q751L

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226293
Predicted Effect probably damaging
Transcript: ENSMUST00000226357
AA Change: Q681L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227746
Predicted Effect probably benign
Transcript: ENSMUST00000228308
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 55832562 missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 55832505 missense probably benign 0.03
IGL01791:Nfatc4 APN 14 55832238 missense probably null 0.04
IGL02536:Nfatc4 APN 14 55829910 missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 55831654 missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 55830028 missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0965:Nfatc4 UTSW 14 55826586 missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 55832631 missense probably damaging 1.00
R2309:Nfatc4 UTSW 14 55827004 missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 55832834 unclassified probably benign
R4200:Nfatc4 UTSW 14 55832032 missense probably damaging 1.00
R4905:Nfatc4 UTSW 14 55830582 missense probably benign 0.16
R5202:Nfatc4 UTSW 14 55826659 missense probably damaging 1.00
R5415:Nfatc4 UTSW 14 55832634 missense probably benign
R5585:Nfatc4 UTSW 14 55826755 missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 55832276 missense probably benign 0.02
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6172:Nfatc4 UTSW 14 55829533 missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 55825055 missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 55831964 missense probably benign 0.19
R7738:Nfatc4 UTSW 14 55831957 missense possibly damaging 0.83
R8309:Nfatc4 UTSW 14 55826391 missense probably damaging 0.99
R8445:Nfatc4 UTSW 14 55826418 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTCCTAGTGGTCTTCAAGGAGG -3'
(R):5'- CTCATTGTAGCCCTCAGGAG -3'

Sequencing Primer
(F):5'- TCTTCAAGGAGGAGCCCCTAC -3'
(R):5'- TAAGGGGTGGATGGCACTC -3'
Posted On2016-06-06