Incidental Mutation 'R5067:Mfng'
ID388387
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene NameMFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsmanic fringe
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78755882-78773475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78764388 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 163 (R163H)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
PDB Structure
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018313
AA Change: R163H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: R163H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136795
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm10337 T A 15: 102,503,871 probably null Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R0504:Mfng UTSW 15 78757314 missense probably benign 0.00
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4925:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5143:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6012:Mfng UTSW 15 78756640 missense probably damaging 1.00
R6654:Mfng UTSW 15 78759339 missense probably damaging 1.00
R7211:Mfng UTSW 15 78773068 missense probably benign 0.12
R7793:Mfng UTSW 15 78773065 missense probably damaging 1.00
R8292:Mfng UTSW 15 78773170 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCATGGTGATTCTAGGTGGC -3'
(R):5'- GCTCCCTGACTCACAGCTATTAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGCTCTCTGATG -3'
(R):5'- CTATTAGCTGTTGACCTCGGGGAC -3'
Posted On2016-06-06