Incidental Mutation 'R5067:Gm10337'
ID388389
Institutional Source Beutler Lab
Gene Symbol Gm10337
Ensembl Gene ENSMUSG00000071586
Gene Namepredicted gene 10337
Synonyms
MMRRC Submission 042657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5067 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102503722-102503886 bp(+) (GRCm38)
Type of Mutationsplice site (4990 bp from exon)
DNA Base Change (assembly) T to A at 102503871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000229618] [ENSMUST00000229854]
Predicted Effect silent
Transcript: ENSMUST00000023812
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096145
AA Change: Y50*
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586
AA Change: Y50*

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect silent
Transcript: ENSMUST00000169377
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000171565
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229822
Predicted Effect probably null
Transcript: ENSMUST00000229854
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T C 12: 112,785,316 N304D probably benign Het
Akr7a5 T C 4: 139,311,022 S90P probably damaging Het
Aplnr T A 2: 85,136,784 V51E probably damaging Het
Arhgap21 A T 2: 20,880,037 H776Q probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Bsn T A 9: 108,111,953 Y2200F probably damaging Het
Btbd10 A T 7: 113,325,836 D268E probably damaging Het
Cacna1h T C 17: 25,397,808 N113D probably damaging Het
Cfap54 T C 10: 93,066,766 N175D probably benign Het
Cfap61 A G 2: 146,102,036 D134G probably damaging Het
Clybl A T 14: 122,379,289 I239L possibly damaging Het
Defb11 A T 8: 21,906,336 F15Y probably damaging Het
Dlc1 A G 8: 36,584,493 S695P probably benign Het
Dscr3 T A 16: 94,526,404 probably benign Het
Fam196a A T 7: 134,918,555 V82E probably benign Het
Fbxl5 T C 5: 43,758,772 K432E probably benign Het
Fryl T C 5: 73,057,755 E2226G probably benign Het
Gm5828 A G 1: 16,769,292 noncoding transcript Het
Gm8674 A T 13: 49,899,834 noncoding transcript Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Ints14 C A 9: 64,964,412 L11M probably damaging Het
Kcp G A 6: 29,492,108 P153L probably benign Het
Lrrk2 A C 15: 91,765,790 N1710T probably benign Het
March10 T A 11: 105,390,107 T451S possibly damaging Het
Mcf2l T G 8: 12,915,959 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Neurod2 T A 11: 98,327,237 H367L possibly damaging Het
Nfatc4 A T 14: 55,832,418 Q681L probably damaging Het
Nkx3-2 T C 5: 41,761,877 N256S probably damaging Het
Ntng1 G A 3: 110,135,345 T55M possibly damaging Het
Snd1 C A 6: 28,888,240 N891K probably damaging Het
Syt7 T C 19: 10,442,858 V382A possibly damaging Het
Trim72 T C 7: 128,009,967 S314P possibly damaging Het
Ttc41 T C 10: 86,744,544 S785P probably damaging Het
Ube2z C T 11: 96,063,009 V128I probably benign Het
Wdr43 T C 17: 71,626,854 Y149H probably benign Het
Wnk4 T A 11: 101,262,856 V248E probably damaging Het
Zcchc2 A T 1: 106,030,964 N1055I probably damaging Het
Zdhhc23 T C 16: 43,973,771 Y180C probably benign Het
Other mutations in Gm10337
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02276:Gm10337 APN 15 102503734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGACCTCTGTACCTGTC -3'
(R):5'- CAAGCTGATGTGCGTGTAGG -3'

Sequencing Primer
(F):5'- CTCATCCTGCTGCTTACCAGATG -3'
(R):5'- AGCCTGGCCAACTCCCTATG -3'
Posted On2016-06-06